Gene HFE Variant 11
DNA : 9.40 KbNT_007592
mRNA : 726 bp NM_139002
CDS : 486 bp NP_620571
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  82 bp
taccttctgctgtaggagagagagaactaaagttctgaaagacctgttgcttttcaccag
gaagttttactgggcatctcctgagcctaggcaatagctgtagggtgacttctggagcca
tccccgtttccccgccccccaaaagaagcggagatttaacggggacgtgcggccagagct
GGGGAAATGGGCCCGCGAGCCAGGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCG
GTCCTGCAGGGGCGCTTGCTGC
gtgagtccgagggctgcgggcgaactaggggcgcggcgggggtggaaaaatcgaaactag
ctttttctttgcgcttgggagtttgctaactttggaggacctgctcaaccctatccgcaa
gcccctctccctactttctgcgtccagaccccgtgagggagtgcctaccactgaactgca
EXON 2  264 bp
aagcacacaaggaaagagcacccaggactgtcatatggaagaaagacaggactgcaactc
acccttcacaaaatgaggaccagacacagctgatggtatgagttgatgcaggtgtgtgga
gcctcaacatcctgctcccctcctactacacatggttaaggcctgttgctctgtctccag
GTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCT
TGTTTGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTC
GCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATGTGGCTGC
AGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGGACTATTA
TGGAAAATCACAACCACAGCAAGG
gtatgtggagagggggcctcaccttcctgaggttgtcagagcttttcatcttttcatgca
tcttgaaggaaacagctggaagtctgaggtcttgtgggagcagggaagagggaaggaatt
tgcttcctgagatcatttggtccttggggatggtggaaatagggacctattcctttggtt
EXON 3  85 bp
aggttgtcagagcttttcatcttttcatgcatcttgaaggaaacagctggaagtctgagg
tcttgtgggagcagggaagagggaaggaatttgcttcctgagatcatttggtccttgggg
atggtggaaatagggacctattcctttggttgcagttaacaaggctggggatttttccag
AGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACCGAGG
GCTACTGGAAGTACGGGTATGATGG
gcaggaccaccttgaattctgccctgacacactggattggagagcagcagaacccagggc
ctggcccaccaagctggagtgggaaaggcacaagattcgggccaggcagaacagggccta
cctggagagggactgccctgcacagctgcagcagttgctggagctggggagaggtgtttt
EXON 4  295 bp
ctctcctgacctcgtgatccgcctgcctcggcctcccaaagtgctgagattacaggtgtg
agccaccctgcccagccgtcaaaagagtcttaatatatatatccagatggcatgtgttta
ctttatgttactacatgcacttggctgcataaatgtggtacaagcattctgtcttgaagg
GCAGGTGCTTCAGGATACCATATACAGCTCAGAAGTTTCTTCTTTAGGCATTAAATTTTA
GCAAAGATATCTCATCTCTTCTTTTAAACCATTTTCTTTTTTTGTGGTTAGAAAAGTTAT
GTAGAAAAAAGTAAATGTGATTTACGCTCATTGTAGAAAAGCTATAAAATGAATACAATT
AAAGCTGTTATTTAATTAGCCAGTGAAAAACTATTAACAACTTGTCTATTACCTGTTAGT
ATTATTGTTGCATTAAAAATGCATATACTTTAATAAATGTATATTGTATTGTATA
ctgcatgattttattgaagttcttgttcatcttgtgtatatacttaatcgctttgtcatt
ttggagacatttattttgcttctaatttctttacattttgtcttacggaatattttcatt
caactgtggtagccgaattaatcgtgtttcttcactctagggacattgtcgtctaagttg