Gene FYN Variant 3
DNA : 97.80 KbNT_025741
mRNA : 1958 bp NM_153048
CDS : 1449 bp NP_694593
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  43 bp
tactatattgtagacctgtgccagaagccagaagaaggcaatgggaagaatcaaagagat
tcttggccccaacccttaccagaccctgccatgcacaggaaacagttaaacaatgtgact
gtctcacctgcaaatgatcaagtgttgggtataagccaaggagctgagagagggggagac
CAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAAGG
gtaagactcgcatgggcctggccggtggacaagatgtgggaactgcatggacagttatgt
ggaggtgcattccatcctggctggagagtgtgtgaggggcagtgggagattggtggaaaa
gatataggccactggtgtggaaggctgggaagccacgcttcagatcggagaaagttgcta
EXON 2  258 bp
tggggtcaaggaactgaacttcctcctaaccatctccccagccactgcctttcctcatgc
cccctaataggcctgaaatagccaacagtgagccttgtcaattactcctcgtttactgta
gagcaacccagcaactagggagcatcccagcttacgtgcccccttttttgtctttggcag
GAATTTAGATAATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGG
AGAGGGACGGCAGCCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTC
AGCACTACCCCAGCTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCG
GGGGCCAAGGACTCACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGC
GTACGAGAGGAGGAACAG
gtaagcccccaaagtcacagagtgcagagagggggcagccacccttaaatcttttggcaa
ttgaacatctgggttcccatcacttccctttgactaggggtttcacatgtaagtttctaa
tctgtctcctctactagatgaggggttgtaagaaaagccagagtttgatgtacaaacaaa
EXON 3  97 bp
ccaaggcataaacacagccctgtgactgtggttttgacacgttaattacaacacttcatc
atgttattagtgctggctagatgtagattgtgagaatgagattttagtgaagatttaatt
tcttggaattaatttccccttgtgtaataatctcccttcttgtgaatttcgtttcggcag
GAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGACCTGAGTT
TTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTC
gtaagtttggagagggaggagaagcatgtatacctttcaggttgggaaggggtcttgcat
ttctggtctgcatctcttcagatgtctgaaatgctaaaagaacatttgctaaattcactg
gtttacaacaatatactttgagaaaaagaagagtcagtgacacagtgcagtattttatgg
EXON 4  99 bp
cgaactggaaccttctgaccttcacagggggactatgttggagttcagagtaaaggaata
ggttggagaaatcgggtggcaggatgattaggtgacagttatacacttcagaccacagtg
agtctctaactgcaagctgttgaaatggtcaacatatttacttttcttttttatttacag
GGAAGGAGATTGGTGGGAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAG
CAATTATGTGGCTCCAGTTGACTCTATCCAGGCAGAAGA
gtatgtttcattttgttttcacttaactacttgattttaaaagttgattgccgcaataaa
atgccatcagcattgggcaggagggagaagaaattcacagcagtgattaaggctgagttt
ttcaggctttctgccccggtttttaccctgtgtaatacttgcactattattaacttaatg
EXON 5  104 bp
ggatagaatccaggatagattgaaaaggaactgaattaagctagaaaaaaaatacatcca
gggaaaggttaaggactaaattggaggagaggggaattcatgggcaaaaaaaaagcctat
gctgttgcattttgtaaatgactatttcaaaatattttctttccttgatctaatttaaag
GTGGTACTTTGGAAAACTTGGCCGAAAAGATGCTGAGCGACAGCTATTGTCCTTTGGAAA
CCCAAGAGGTACCTTTCTTATCCGCGAGAGTGAAACCACCAAAG
gtaagataacgagttgaagaagttggcttgtcattcaaatctgtggattagtcagagggg
atgaaaggcttatctctaatgtacaaggattttaaaatggcacataccctccctgccttg
tgagtggagtcctgttttcagtcttccctccaggctctaaaactgcagacagcaccaaaa
EXON 6  150 bp
tctgacatttgcagaacatcaagaagcatcttcttcctgttactgagtggagatgctgtg
tgtgtgtacatgtgtgtgtgcatccttggtaattattaatcagagtcaagaaaatgaggc
ctaaaaagcaagctgatactctaaatgattggagctgctaatgctttccacgtttaccag
GTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTCAAACATT
ATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAGTTTGAAA
CACTTCAGCAGCTTGTACAACATTACTCAG
gtaaccttaattctaactacctactaaccatttggatgctggagggagtggataggccca
gagcaggaaagtggaaaggggtaaaactaatatgtacaaaatcacttatagagtatgttt
tctttgccagcccttaatggtagggcttggctgtataggttctattgctattgttctact
EXON 7  180 bp
actcattttttctgttaaaatacttgacagagtccttgcaattgaatgtctttgttcaac
aaaaactgtattaagtgttttaaatttaaaatctaatcttatgcaaatagctggtggtca
aaacctttttccatcaaaagaagatctttggtttgacttcatattctgggatgtttgtag
GTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACTCTTAAACCAGGCACAATGTCCC
CCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAGCTGAAGCACGACAAGCTGGTCC
AGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATCGTCACCGAGTATATGAACAAAG

gttgggcaacacctctcctgtctccagctcacagtgccttaaggggttgtttaggggaga
gaaatggaagtttcctacttgctacttttctagtttctgcctgggtcaagtattcccatt
aggaaccaccagttatgtgctcgttaatgaaaacattttttaaaacagactaaccttgcg
EXON 8  77 bp
cttctccatgcctatacttttttctaccctgcttttttatataaacctttttgtcccccc
atgtggatggcattattccatttgactaccttattacttttaataagaaaaccaaataca
gctctctgttgggaattatctttcaaagtaaattgaaatgattttatgttttgttcatag
GAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGAGCTCTGAAATTACCAAATCTTG
TGGACATGGCAGCACAG
gtaggccctgcagggtaacttgatgtgccatagatttaatgacgtgtctaagtacattgg
gtcgtggtgtaacatgtcctgttccctgggtttccacaggtggctgcaggaatggcttac
atcgagcgcatgaattatatccatagagatctgcgatcagcaaacattctagtggggaat
EXON 9  154 bp
ataggaagtttactggatttcttaaaagatggagaaggaagagctctgaaattaccaaat
cttgtggacatggcagcacaggtaggccctgcagggtaacttgatgtgccatagatttaa
tgacgtgtctaagtacattgggtcgtggtgtaacatgtcctgttccctgggtttccacag
GTGGCTGCAGGAATGGCTTACATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCA
GCAAACATTCTAGTGGGGAATGGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGA
TTGATAGAAGACAATGAGTACACAGCAAGACAAG
gtgggcacttgaatgacaatggctcgtgatcacagctgtgagaacagtcacttactgcac
agcccttccttcctccttcccttcccttccttcagaaaatacttgaaatgtcattcttca
gcttggtttggacaccttgatctggcaggaatttgacagctctgcaggtgggagactgtt
EXON 10  132 bp
cacagtcaagaccagaccctacatcttcccaatcccagcccattcctgcttcacctcctt
tctgtcttcccctctaaacctgctctcaggaaagtagcttgccaagtgcctttccctccc
acaccccatgcccattgcagtgccctctgcctgatgaataaccaagtgttcattctgcag
GTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTACGGGAGGTTCACAA
TCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTCACCAAAGGAAGAG
TGCCATACCCAG
gtaagagcagggcctcacagacatgggcctgagattggaggcttttttgacaccatttgg
gaaaacttcatccactttgctttctaagccccatcctcagctttctgctgagcttgagtt
tgaagaacatggccaggtattcagcgagagaaaagcagaactgggagccaccatgtatgt
EXON 11  664 bp
agttctgcactccttctttactcctgagtagcatggcagggtttgactcctggggggatg
ggagtactccgcatgttttagccacatgcagacgcaaagaagaagaaaggggatctgcaa
gtgcggcggtcagggcctggatccccggggtgcccactctcactgcgcttgtctttgcag
GCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAGCGAGGCTACAGGATGCCCTGCCCGC
AGGACTGCCCCATCTCTCTGCATGAGCTCATGATCCACTGCTGGAAAAAGGACCCTGAAG
AACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTGGAAGACTACTTTACCGCGACAGAGC
CCCAGTACCAACCTGGTGAAAACCTGTAAGGCCCGGGTCTGCGGAGAGAGGCCTTGTCCC
AGAGGCTGCCCCACCCCTCCCCATTAGCTTTCAATTCCGTAGCCAGCTGCTCCCCAGCAG
CGGAACCGCCCAGGATCAGATTGCATGTGACTCTGAAGCTGACGAACTTCCATGGCCCTC
ATTAATGACACTTGTCCCCAAATCCGAACCTCCTCTGTGAAGCATTCGAGACAGAACCTT
GTTATTTCTCAGACTTTGGAAAATGCATTGTATCGATGTTATGTAAAAGGCCAAACCTCT
GTTCAGTGTAAATAGTTACTCCAGTGCCAACAATCCTAGTGCTTTCCTTTTTTAAAAATG
CAAATCCTATGTGATTTTAACTCTGTCTTCACCTGATTCAACTAAAAAAAAAAAAGTATT
ATTTTCCAAAAGTGGCCTCTTTGTCTAAAACAATAAAATTTTTTTTCATGTTTTAACAAA
AACC
aatcaggacaggtgtttgtttttgttttcttttttataaatatgaatatatataatatat
atgtccctgtacatatacaatgtgggtgctaatgtggagactgtggccggcctgagccac
caagctgcgggacccagagggaggattttactgcaagtcagcatcaaagcaccggtgtta