Gene FYN Variant 1
DNA : 212.14 KbNT_025741
mRNA : 2650 bp NM_002037
CDS : 1926 bp NP_002028
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  457 bp
cggcggccccacctactgccgtcccgcccacgccccaggcgccaatggttgcggctcgca
gctcccaaggggctctttgatagggcagccgggcctgtcactctcgaggcgcgccccgcc
ccctcctcgctcccctccggagctggaggggcagagcatcagcaagagtagcagcgagca
GCCGCGCTGGTGGCGGCGGCGCGTCGTTGCAGTTGCGCCATCTGTCAGGAGCGGAGCCGG
CGAGGAGGGGGCTGCCGCGGGCGAGGAGGAGGGGTCGCCGCGAGCCGAAGGCCTTCGAGA
CCCGCCCGCCGCCCGGCGGCGAGAGTAGAGGCGAGGTTGTTGTGCGAGCGGCGCGTCCTC
TCCCGCCCGGGCGCGCCGCGCTTCTCCCAGCGCACCGAGGACCGCCCGGGCGCACACAAA
GCCGCCGCCCGCGCCGCACCGCCCGGCGGCCGCCGCCCGCGCCAGGGAGGGATTCGGCCG
CCGGGCCGGGGACACCCCGGCGCCGCCCCCTCGGTGCTCTCGGAAGGCCCACCGGCTCCC
GGGCCCGCCGGGGACCCCCCGGAGCCGCCTCGGCCGCGCCGGAGGAGGGCGGGGAGAGGA
CCATGTGAGTGGGCTCCGGAGCCTCAGCGCCGCGCAG
gtaagcaggcggcggggatgcgtcgcgggaggcctcggggatgctgcggagaagcccggc
cgccggcgcccccgcgcacgccgcccccgccgcagggcccggtgctgcggtcccttggcc
gccagggcgctccgcggggctgccggggagtcggtgcttggggtcttcccgcggttgcac
EXON 2  41 bp
cagacaggtgtttgtggcaactgtgacttagcaacaattgtgtgaatgataaaaaatttg
tgggcaaattgattgtctgcaacaaatggaaattctatggtggtgctttgtgggtggttt
gtaggcagagagtacttggttctcttttgatgtctcacttttttttttcttcttctacag
TTTTTTTGAAGAAGCAGGATGCTGATCTAAACGTGGAAAAA
gtaagttggcaagttttgcactgagagcaagtgccttgtgaattataaagggcttcctgt
tggaacctaggatgaagtccacttttaatttgggattgtaattctgagtccatagatttc
taagagagaggtcgagttggagaaggaactggtttgtgaaatagaaagaaaaccttacct
EXON 3  70 bp
tttgtaaattggtttcatcttcctgggaaaaacagaggaaactggtaggtggaatttagt
acatcgatgggtgcccgaagcagaggaagaggttgcagtttacagagagaaacataatat
gtgttcaattatttctgtttaatgatgtggtttttcttttgttgtggtattgtttttcag
GACCAGTCCTGCCTCTGTTGTAGAAGACATGTGGTGTATATAAAGTTTGTGATCGTTGGC
GGACATTTTG
gtaagtgttgctgcatttacttctaatgcctcttgctgtaaaagggtgctcacgaaggga
agctgttgccttgttctgtccatcttttacttctgcactaaactcaggcagaatggagtt
ctataattaaatgtgacattgaattgatgttttctgacagtgtgatactttttcttgtta
EXON 4  258 bp
tggggtcaaggaactgaacttcctcctaaccatctccccagccactgcctttcctcatgc
cccctaataggcctgaaatagccaacagtgagccttgtcaattactcctcgtttactgta
gagcaacccagcaactagggagcatcccagcttacgtgcccccttttttgtctttggcag
GAATTTAGATAATGGGCTGTGTGCAATGTAAGGATAAAGAAGCAACAAAACTGACGGAGG
AGAGGGACGGCAGCCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTC
AGCACTACCCCAGCTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCG
GGGGCCAAGGACTCACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGC
GTACGAGAGGAGGAACAG
gtaagcccccaaagtcacagagtgcagagagggggcagccacccttaaatcttttggcaa
ttgaacatctgggttcccatcacttccctttgactaggggtttcacatgtaagtttctaa
tctgtctcctctactagatgaggggttgtaagaaaagccagagtttgatgtacaaacaaa
EXON 5  97 bp
ccaaggcataaacacagccctgtgactgtggttttgacacgttaattacaacacttcatc
atgttattagtgctggctagatgtagattgtgagaatgagattttagtgaagatttaatt
tcttggaattaatttccccttgtgtaataatctcccttcttgtgaatttcgtttcggcag
GAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGACCTGAGTT
TTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTC
gtaagtttggagagggaggagaagcatgtatacctttcaggttgggaaggggtcttgcat
ttctggtctgcatctcttcagatgtctgaaatgctaaaagaacatttgctaaattcactg
gtttacaacaatatactttgagaaaaagaagagtcagtgacacagtgcagtattttatgg
EXON 6  99 bp
cgaactggaaccttctgaccttcacagggggactatgttggagttcagagtaaaggaata
ggttggagaaatcgggtggcaggatgattaggtgacagttatacacttcagaccacagtg
agtctctaactgcaagctgttgaaatggtcaacatatttacttttcttttttatttacag
GGAAGGAGATTGGTGGGAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAG
CAATTATGTGGCTCCAGTTGACTCTATCCAGGCAGAAGA
gtatgtttcattttgttttcacttaactacttgattttaaaagttgattgccgcaataaa
atgccatcagcattgggcaggagggagaagaaattcacagcagtgattaaggctgagttt
ttcaggctttctgccccggtttttaccctgtgtaatacttgcactattattaacttaatg
EXON 7  104 bp
ggatagaatccaggatagattgaaaaggaactgaattaagctagaaaaaaaatacatcca
gggaaaggttaaggactaaattggaggagaggggaattcatgggcaaaaaaaaagcctat
gctgttgcattttgtaaatgactatttcaaaatattttctttccttgatctaatttaaag
GTGGTACTTTGGAAAACTTGGCCGAAAAGATGCTGAGCGACAGCTATTGTCCTTTGGAAA
CCCAAGAGGTACCTTTCTTATCCGCGAGAGTGAAACCACCAAAG
gtaagataacgagttgaagaagttggcttgtcattcaaatctgtggattagtcagagggg
atgaaaggcttatctctaatgtacaaggattttaaaatggcacataccctccctgccttg
tgagtggagtcctgttttcagtcttccctccaggctctaaaactgcagacagcaccaaaa
EXON 8  150 bp
tctgacatttgcagaacatcaagaagcatcttcttcctgttactgagtggagatgctgtg
tgtgtgtacatgtgtgtgtgcatccttggtaattattaatcagagtcaagaaaatgaggc
ctaaaaagcaagctgatactctaaatgattggagctgctaatgctttccacgtttaccag
GTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTCAAACATT
ATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAGTTTGAAA
CACTTCAGCAGCTTGTACAACATTACTCAG
gtaaccttaattctaactacctactaaccatttggatgctggagggagtggataggccca
gagcaggaaagtggaaaggggtaaaactaatatgtacaaaatcacttatagagtatgttt
tctttgccagcccttaatggtagggcttggctgtataggttctattgctattgttctact
EXON 9  165 bp
gcgctgtttaaggagcgctgtgtgctgctagtgttccacgatgtgtgtggtcgtctgctg
gtgtagtagcactgtttgaggagcactgtgcgccgctagtgtgggtttacacttatgagt
gttgtcattacatgtgttctgctcttctctccctctcctgcccctgccctgctccatcag
AGAGAGCTGCAGGTCTCTGCTGCCGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAGGC
TTACCGATCTGTCTGTCAAAACCAAAGATGTCTGGGAAATCCCTCGAGAATCCCTGCAGT
TGATCAAGAGACTGGGAAATGGGCAGTTTGGGGAAGTATGGATGG
gtatgctgagactcaattactctcttattagcttccccgtttggaagatcccaaacacca
aagatggaaggtgaaaataaagactgcgtgaccgggaagaaagtttgaattactaatagt
ggggaataataatttcagttttggttttaacattctggaattcctaaaaaaaaaaaaaaa
EXON 10  180 bp
actcattttttctgttaaaatacttgacagagtccttgcaattgaatgtctttgttcaac
aaaaactgtattaagtgttttaaatttaaaatctaatcttatgcaaatagctggtggtca
aaacctttttccatcaaaagaagatctttggtttgacttcatattctgggatgtttgtag
GTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACTCTTAAACCAGGCACAATGTCCC
CCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAGCTGAAGCACGACAAGCTGGTCC
AGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATCGTCACCGAGTATATGAACAAAG

gttgggcaacacctctcctgtctccagctcacagtgccttaaggggttgtttaggggaga
gaaatggaagtttcctacttgctacttttctagtttctgcctgggtcaagtattcccatt
aggaaccaccagttatgtgctcgttaatgaaaacattttttaaaacagactaaccttgcg
EXON 11  77 bp
cttctccatgcctatacttttttctaccctgcttttttatataaacctttttgtcccccc
atgtggatggcattattccatttgactaccttattacttttaataagaaaaccaaataca
gctctctgttgggaattatctttcaaagtaaattgaaatgattttatgttttgttcatag
GAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGAGCTCTGAAATTACCAAATCTTG
TGGACATGGCAGCACAG
gtaggccctgcagggtaacttgatgtgccatagatttaatgacgtgtctaagtacattgg
gtcgtggtgtaacatgtcctgttccctgggtttccacaggtggctgcaggaatggcttac
atcgagcgcatgaattatatccatagagatctgcgatcagcaaacattctagtggggaat
EXON 12  154 bp
ataggaagtttactggatttcttaaaagatggagaaggaagagctctgaaattaccaaat
cttgtggacatggcagcacaggtaggccctgcagggtaacttgatgtgccatagatttaa
tgacgtgtctaagtacattgggtcgtggtgtaacatgtcctgttccctgggtttccacag
GTGGCTGCAGGAATGGCTTACATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCA
GCAAACATTCTAGTGGGGAATGGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGA
TTGATAGAAGACAATGAGTACACAGCAAGACAAG
gtgggcacttgaatgacaatggctcgtgatcacagctgtgagaacagtcacttactgcac
agcccttccttcctccttcccttcccttccttcagaaaatacttgaaatgtcattcttca
gcttggtttggacaccttgatctggcaggaatttgacagctctgcaggtgggagactgtt
EXON 13  132 bp
cacagtcaagaccagaccctacatcttcccaatcccagcccattcctgcttcacctcctt
tctgtcttcccctctaaacctgctctcaggaaagtagcttgccaagtgcctttccctccc
acaccccatgcccattgcagtgccctctgcctgatgaataaccaagtgttcattctgcag
GTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTACGGGAGGTTCACAA
TCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTCACCAAAGGAAGAG
TGCCATACCCAG
gtaagagcagggcctcacagacatgggcctgagattggaggcttttttgacaccatttgg
gaaaacttcatccactttgctttctaagccccatcctcagctttctgctgagcttgagtt
tgaagaacatggccaggtattcagcgagagaaaagcagaactgggagccaccatgtatgt
EXON 14  666 bp
agttctgcactccttctttactcctgagtagcatggcagggtttgactcctggggggatg
ggagtactccgcatgttttagccacatgcagacgcaaagaagaagaaaggggatctgcaa
gtgcggcggtcagggcctggatccccggggtgcccactctcactgcgcttgtctttgcag
GCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAGCGAGGCTACAGGATGCCCTGCCCGC
AGGACTGCCCCATCTCTCTGCATGAGCTCATGATCCACTGCTGGAAAAAGGACCCTGAAG
AACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTGGAAGACTACTTTACCGCGACAGAGC
CCCAGTACCAACCTGGTGAAAACCTGTAAGGCCCGGGTCTGCGGAGAGAGGCCTTGTCCC
AGAGGCTGCCCCACCCCTCCCCATTAGCTTTCAATTCCGTAGCCAGCTGCTCCCCAGCAG
CGGAACCGCCCAGGATCAGATTGCATGTGACTCTGAAGCTGACGAACTTCCATGGCCCTC
ATTAATGACACTTGTCCCCAAATCCGAACCTCCTCTGTGAAGCATTCGAGACAGAACCTT
GTTATTTCTCAGACTTTGGAAAATGCATTGTATCGATGTTATGTAAAAGGCCAAACCTCT
GTTCAGTGTAAATAGTTACTCCAGTGCCAACAATCCTAGTGCTTTCCTTTTTTAAAAATG
CAAATCCTATGTGATTTTAACTCTGTCTTCACCTGATTCAACTAAAAAAAAAAAAGTATT
ATTTTCCAAAAGTGGCCTCTTTGTCTAAAACAATAAAATTTTTTTTCATGTTTTAACAAA
AACCAA
tcaggacaggtgtttgtttttgttttcttttttataaatatgaatatatataatatatat
gtccctgtacatatacaatgtgggtgctaatgtggagactgtggccggcctgagccacca
agctgcgggacccagagggaggattttactgcaagtcagcatcaaagcaccggtgttatt