Gene DUSP22 Variant 1
DNA : 59.26 KbNT_034880
mRNA : 1483 bp NM_020185
CDS : 555 bp NP_064570
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  464 bp
gggaaaaggccaaagggggatctggagacccccggccggggagcgggctccgagacgagc
gcagccgcccggtcagggcagcgcctgcgcgtccgccaggccccgccgcgcagcctcggg
tgtcccggcggggcggctcgggccgcgcacgcgctctggcctccggggccggccgcctgg
GAGCCCGAGCCTAGTGCCTCCCACGCCCGGCGGCCGCGAGCCGGGGTCCGCGAGGGCGGA
GTGGGGCGCGGCAGCCAGGAACCCGACTACGAATCCCAGGGTGCGGGCGGGCGGAGCGAG
GAGGGACGCTGGGCCTGCCCGGTGCGCACGGGGGCGGGGACCGGCAAGGCGGGACCATTT
CCCGGCATAGGCTCCGGTGCCCCTGCCCGGCTCCCGCCGGGAAGTTCTAGGCCGCCGCAC
AGAAAGCCCTGCCCTCCACGCCGGGTCTCTGGAGCGCCCTGGGTTGCCCGGCCGGTCCCT
GCCGCTGACTTGTTGACACTGCGAGCACTCAGTCCCTCCCGCGCGCCTCCTCCCCGCCCG
CCCCGCCGCTCCTCCTCCCTGTAACATGCCATAGTGCGCCTGCGACCACACGGCCGGGGC
GCTAGCGTTCGCCTTCAGCCACCATGGGGAATGGGATGAACAAG
gtaacgtcttccctcgttcgcgctgggtttgcctccgctccgacgccctgccgtctcgcc
ggcgtcggctgcccgacgactcgagcccggggtgccctttcccgcggtggggacgggcgc
ggagggaggggcggcgcgcctgggcggcgaccgcggagtcggggttcggaggtgttcccg
EXON 2  34 bp
aacccacggccttccacaggccgctggggatgttgggtcacccgcgtgtctgtcagggag
gtgctgtactggggaagcacctggcctttgcagggatcctgctgctggatgaggccccct
tctgcaataccatccacttagagtctgccatgctcatgtctgtgtctgtctctctcctag
ATCCTGCCCGGCCTGTACATCGGCAACTTCAAAG
gtgagttcttgcttttttattgttgtgataaaatacacataacataaaatgtgtcatctt
gaccattttaaagtgtataggtcagtggctttaagtaatttgcattgctgtgcagccatc
accaacatccttctgcaggacttttcatgttcccaaactgaaactgtgtcccttaaaaca
EXON 3  83 bp
aagttaggcaaaatatatgaaagcagtagccctaagtttcctacatgtatggtcagttat
gaagtttcaggaaagaaatatgcaagtcattttgtgggtttttttttttttctggctaga
ctttaggagtaattaacttgcaaagatatcaaaatgtccatcccctttcttctctgacag
ATGCCAGAGACGCGGAACAATTGAGCAAGAACAAGGTGACACATATTCTGTCTGTCCACG
ATAGTGCCAGGCCTATGTTGGAG
gtaagagagcaccgtggggcgtgtgtgggtgtcctcatttgtattccgtgggagtaccta
cgacgttaatgaaggcaaccaggttctctccaatgcgaacgtactcctgtgatctctggc
ggcattcccattgtgttcaggccgtgttgatgttaacacgctgtctgtagcgtggcgcga
EXON 4  50 bp
cggaaaataaccaggaactttaattagtttttctgcagttccttggcaacaaaagatgag
tgaaaaacttctcctttttatttttttattttttgacctgtgtaaatagttccttaaata
cttttctccactgagtttcatgtttttatttttatgtatttactttttattattctgcag
GGAGTTAAATACCTGTGCATCCCAGCAGCGGATTCACCATCTCAAAACCT
gtaagtttcttatttctgtattatttggagacatttaaaaaaatgaatagaggatggtaa
agtcagagaagtagaagactgtgaagttgtcagagctcacgggacccttgctgaccctgc
cagggaagaggctgtgagcctacagaggccaacgctaggcaggctgggatgagctgtggc
EXON 5  75 bp
ttatacaatgtatacatgcattgaagtgtcacactgtagcccataaatatgtagaattat
gtgtcaattatacaaaaaaatcaattaacattttaagaaagaagcctcaggtagaatttt
cttttcatcatatattgagtaaagtagagagatgtcatttctctttttttcttttcccag
GACAAGACATTTCAAAGAAAGTATTAAATTCATTCACGAGTGCCGGCTCCGCGGTGAGAG
CTGCCTTGTACACTG
gtacgtgtgtctcttgcttaatagcgccttagcgtattctggtcggcttggcttcccatc
aagtgtttttccgtgtgtgaataatggtttcacctcctaatagttttctgtaaaccctga
ctctcaaacgcgtgctccatttgtccagcgctgtgtgttagtcgccctttccttctgttg
EXON 6  172 bp
agggagctggtacgttgagtgctgagtggcttcctggtggcgagcttgctgtccacatat
aatccaaggcaggaagactttctgaacaaggtccttagagtcccccgctccacatggatt
gggcgatgaacccggagatctgaaactgccctcacacatgtgcttctcttggccccgcag
CCTGGCCGGGGTCTCCAGGAGCGTGACACTGGTGATCGCATACATCATGACCGTCACTGA
CTTTGGCTGGGAGGATGCCCTGCACACCGTGCGTGCTGGGAGATCCTGTGCCAACCCCAA
CGTGGGCTTCCAGAGACAGCTCCAGGAGTTTGAGAAGCATGAGGTCCATCAG
gtaagcagttcttaggggacatcagagatgcaggcaggtgcccctgaacggtgcccacag
tctttccgtacacagccagcatcatggcgtttggagttgaaaggcccacagaggacatcg
gctcccagggcgcccagctgcaccccttcagaagtcgtcacgatccctcgtgcacctgtt
EXON 7  73 bp
agcagttccttctcttgcttgaccctggctggccaaccacagagctctgatttcccactg
ctgtttgtttccctggttatgtgtggcaccatctctgtggtgaagtcacaggtgcaagcc
cacgtggatgcagacgtgcacatgtgtgtgacgtttcgggtttgtttccatcctctccag
TATCGGCAGTGGCTGAAGGAAGAATATGGAGAGAGCCCTTTGCAGGATGCAGAAGAAGCC
AAAAACATTCTGG
gtaaatataaggagcaagggcgcacagagccccagcccggcgccaggcggtggagcagtt
ttccggcactggctccgctgacctacgataattatacgacggagacctaacgcaagcgac
ctgctgccttccttcccactgcttgtcttcagtgtgcccggctgggcaggggtgcggtgg
EXON 8  532 bp
caatttgccaataaagtacatgtttttcctaagccaaaaataaatacgttaacagaaaaa
tgatttaggatatagcttgaatgcttaaatatgtgcacctttacaaacctctcagtgtat
tcttggagttcttgaaatgttgttttaatatttgttgccagtaatgttctttcttcacag
CCGCTCCGGGAATTCTGAAGTTCTGGGCCTTTCTCAGAAGACTGTAATGTACCTGAAGTT
TCTGAAATATTGCAAACCCACAGAGTTTAGGCTGGTGCTGCCAAAAAGAAAAGCAACATA
GAGTTTAAGTATCCAGTAGTGATTTGTAAACTTGTTTTTCATTTGAAGCTGAATATATAC
GTAGTCATGTTTATGTTGAGAACTAAGGATATTCTTTAGCAAGAGAAAATATTTTCCCCT
TATCCCCACTGCTGTGGAGGTTTCTGTACCTCGCTTGGATGCCTGTAAGGATCCCGGGAG
CCTTGCCGCACTGCCTTGTGGGTGGCTTGGCGCTCGTGATTGCTTCCTGTGAACGCCTCC
CAAGGACGAGCCCAGTGTAGTTGTGTGGCGTGAACTCTGCCCGTGTGTTCTCAAATTCCC
CAGCTTGGGAAATAGCCCTTGGTGTGGGTTTTATCTCTGGTTTGTGTTCTCCGTGGTGGA
ATTGACCGAAAGCTCTATGTTTTCGTTAATAAAGGGCAACTTAGCCAAGTTT
aaggtcgcgtgcgatgcattcttccctagccaaggggcagtcaccacgcgcccttctgcc
tgtgagggattccaaggcaagactgaagcctactcctggttttattttagaggctattgt
ttgcctccagaaggcgctatagcagatgctacaaaaggtgaattcatgtctccaagaaag