Gene DTNBP1 Variant 1
DNA : 140.17 KbNT_007592
mRNA : 1329 bp NM_032122
CDS : 1056 bp NP_115498
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  164 bp
aatgagccgaggagctactggccctctcggtcgggggaagacccgccccttttccgcagc
ccgagcccggcgcagtccactgcggctgcgcgagcctggcgcgcgcggggcgggaacgcg
gaaggggctggggttgcggcgcggcggcgaggaccagaccgggggcggggccggtagtgg
GAGTGCGGGGCGCGCGGTGACAGCGCGGGGTTGGCGGCGTGGGACCCAGGGGGCGACAGA
GGCAGCAGCAGCCCGAGGCCTGAGGAGAGGAGACCGGCGGCGGCGGCAATGCTGGAGACC
CTTCGCGAGCGGCTGCTGAGCGTGCAGCAGGATTTCACCTCCGG
gtgggtatacggtgggcgacgaaaagggacctgagggggccgggccgccgcctgggatgc
ccctgcctcgctcccttccccgcgccacggtccagggtccgtcctgtcccgcacctcccc
gccccgccccgccgaggaaagtaacgaacttcccggcgtcctcgcgtcgggcggcgcaaa
EXON 2  54 bp
atagtcccagctactcaggaggatgaggtgggaggatcacttgggcccaggattgaggct
gcagtgagtaatgtacatgtcactgcactccagcctggacgacagagtgagaccctgtct
caaaaaaataataataatctcttgacttgtaaaaatattatattttatattgaattatag
GCTGAAGACTTTAAGTGACAAGTCAAGAGAAGCAAAAGTGAAAAGCAAACCCAG
gtaagcttgtgctaagattttaacttaactgtgacttaaatttcatacaacttttggtgt
attcacaattgtgtagttatattaatgaaccttagatttgttgagtgcatctgactacaa
aataatttatcgattctttctaaattttgtaacaggaaaattttctaataaaatcgtgaa
EXON 3  51 bp
tgtgttacatacagtacattaactctgaaataaaacacatttctctaaaagtttaataat
tgtcattagtgattttaaaatatattacaattgacaatgtcaaaattcttgtatgtacct
ttttttttttttcagttggctaaatcaagaacagttttaataagtgtttcttttgggcag
GACTGTTCCATTTTTGCCAAAGTACTCTGCTGGATTAGAATTACTTAGCAG
gtaagtgtttcatttgtagaggaaggttatacttctgacttttttactgaccaaaaatat
cttttaattttgtaggttaaaagccttaaaacagctaaattttatcttaatgcagtgatt
ggaaattatttatgtattattttccttgagggctttcacttttcactcattagtacaaag
EXON 4  61 bp
ttgtcacagatttggccactggaagctctgtcaagttgacgtctgtgtccttgcaacatg
tccccattattttttgagtgtttcctttctagcaccacaggatattccacattcatcttt
agatagtatttccttttaatgtgtggtttgcatttcaaattattttttgcttttttttag
GTATGAGGATACATGGGCTGCACTTCACAGAAGAGCCAAAGACTGTGCAAGTGCTGGAGA
G
gtaaagaattgactaatcttatactcgtggcaaactttcctttttcagtgctaaatggta
ttttttaaaaattgaatttataattgtttgtgtcaaaatgttttgcaggatatctgaaat
tgaatctagtcgttgattatgaaactccctgaataaagcacctttttatcatttctctgt
EXON 5  133 bp
ctgaatattaagttgtttcttttctaaaaatgaaaacaacttcagtctcttttagaatgt
accgtaatctctactgagtagaggggttgttaaagataacattaaatctcattacgttaa
ctgtactttctttgtgcctaaaacctggtttcactttaccccccttcttgtgtgctgcag
CTGGTGGATAGCGAGGTGGTCATGCTTTCTGCGCACTGGGAGAAGAAAAAGACAAGCCTC
GTGGAGCTGCAAGAGCAGCTCCAGCAGCTCCCAGCTTTAATCGCAGACTTAGAATCCATG
ACAGCAAATCTGA
gtaagtccaatgttttcattgtacattacttttaggaatgaaaacaacttgggcagggtt
tggtgtaatttcagagcttttcaggaacacatgaaattctgggttaacaggattttttgg
aaaatcatgatttcatattttgattagttgaggattccacagaaaatgatgtaaagtgta
EXON 6  133 bp
ttgaattatggtttaatgttggccagtatattttattttgcttcaagaaagtttaataaa
aaacattaaaaatgcaaaacaatctcaacaatgtgaacttttacctttttgatacttttt
gtattcatcatgattgaggattctgacttttgaggtctgtttatttttatatactttcag
CTCATTTAGAGGCGAGTTTTGAGGAGGTAGAGAACAACCTGCTGCATCTGGAAGACTTAT
GTGGGCAGTGTGAATTAGAAAGATGCAAACATATGCAGTCCCAGCAACTGGAGAATTACA
AGAAAAATAAGAG
gtgagtttgaaaagtttgccacagtattcattccagtctcgaagttttccatattacttt
acatgctactctttagaagtcccggctgataaaagacaaaggtttcaacataaaactgat
aaataagctttccaaaactttttttaaaaaccactgtctgttgccatcttttggagatga
EXON 7  23 bp
aatagttggtttaggctcattgtactggtcatttcagtaaagtataactgatatgtgaag
atccagaaataccactgtgggcatttaaagtacataagtttttattatgatggaagaaca
gttttcattggggagatttttaatttgcattgtcttgtcttttttttttttttcctacag
GAAGGAACTTGAAACCTTCAAAG
gtaattttgtgttaattcttcactttaaagtagttgagagttcattggtatcagatgttc
tctcgacaatgatgaacaaactcattttttaaaatcagtttacataaaacagtaaaactt
aatactgttttttgtaggttttgcttaatcacaggtggttttgatattctctttagcaca
EXON 8  156 bp
aggaagtgcagcagattgggggacaaggaggccagctgtacacgcagtcggggcaccagc
ccagtctgtaaacgcggcatgactccatccacttggagggtggatgcgagcagctgttta
tacccatttcctctctcagtcccttttcaaaccctaaccccagttattctgtttcctcag
CTGAACTAGATGCAGAGCACGCCCAGAAGGTCCTGGAAATGGAGCACACCCAGCAAATGA
AGCTGAAGGAGCGGCAGAAGTTTTTTGAGGAAGCCTTCCAGCAGGACATGGAGCAGTACC
TGTCCACTGGCTACCTGCAGATTGCAGAGCGGCGAG
gcgagtgggggctggggctgctggtgtggggactcaccggctgtgcggggtggcgatgga
cccctctccccagagcagggcatggggcagaatcctcagaagttccgttctgttatgaga
ccccagcaaccaaaatgtgtgcgtcgggccacctctctcttgccctgcttttgcctcttc
EXON 9  144 bp
tgatttaggatgcatttaaagtgccagactggcatatgtcatctactaatacgttgcttc
aaattccattttgaaggaagcttaggaaatgcaatgtagttagcctaatgccaatggaag
ttcaccttttaaagtaatattaaagacagcgtgtcctttctcgtgttgatctatccgcag
AGCCCATAGGCAGCATGTCATCCATGGAAGTGAACGTGGACATGCTGGAGCAGATGGACC
TGATGGACATATCGGACCAGGAGGCCCTGGACGTCTTCCTGAACTCTGGAGGAGAAGAGA
ACACTGTGCTGTCCCCCGCCTTAG
gtagggttgacaaacttgcattagctgaaccagggcagtatcgatgccactcccctccaa
aggtgagacgtgagaaccatctgccagtcacttacgcataaacccccaagctcacagcca
gctcctggctccctaaccccacggttccacacggctgtgtggcagctgcaacagtggtgt
EXON 10  410 bp
cctctggcatcgctcagctcagtgtcttccagggcagttcccaagttctgcaggccccag
gtgcctggaacaaaaaccacacccccctttcatgacgggcacattccacagctgttggcg
gcaattctgattcacaatatttttatgacagggctttttcttccctacgttattttgcag
GGCCTGAATCCAGTACCTGTCAGAATGAGATTACCCTCCAGGTTCCAAATCCCTCAGAAT
TAAGAGCCAAGCCACCTTCTTCTTCCTCCACCTGCACCGACTCGGCCACCCGGGACATCA
GTGAGGGTGGGGAGTCCCCCGTTGTTCAGTCCGATGAGGAGGAAGTTCAGGTGGACACTG
CCCTGGCCACATCACACACTGACAGAGAGGCCACTCCGGATGGTGGTGAGGACAGCGACT
CTTAAATTGGGACATGGGCGTTGTCTGGCCACACTGGAATCCAGTTTTGGCTGTATGCGG
AATTCCACCTGGAAAGCCAGGTTGTTTTATAGAGGTTCTTGATTTTTACATAATTGCCAA
TAATGTGTGAGAAACTTAAAGAACAGCTAACAATAAAGTGTGAGGACGGT
aaactgagagcgcacagagctagtttgtacacaaaggcttctaaatacacatgtccttaa
ggccactgtaactcagggttccttagagtgaagggacgtgcaggtcattgagggccaccc
cgggaggttgcatgtgggcagggcctgggccaggtggtggaggctccacagggctgagtt