Gene DAAM2 Variant 1
DNA : 111.85 KbNT_007592
mRNA : 6221 bp NM_015345
CDS : 3204 bp NP_056160
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  126 bp
ctgacaactttttggtggtggcttttccgggttcggcttgaaccttcacttggctgggct
gaagtcttcacaagcccccagctcccacttgcaggcctggcctctggccagtgggcaggg
cagccgtaaggttcttgttctcagtggcagtgggaccctgggcgggggaaggagcatctc
AGGAAAGGGGTCCCCGGACTCTGGGGCTCTCAGCACCTGCGGTCGCAAACCAACCTCATG
CCCTGACTTTACCAGGCGTCGGGACTCTGACTTAACCGGGGAATGAGGGACTTGGTCTGG
CGGCAG
gtaattttgtgaagaggatgagaaggaagagggggaggtggtggtgatggccaggacgct
gtggccctgtgtccagccgtagcttgggagtgggatggttggttctgccacatggccacg
gtgaggtacgtgccaggttctccaggagtgccgcgtgtggtgccccaaacaagatgcaag
EXON 2  224 bp
agctggagggaacagagggatgctgtgggaggaggggcgacagcggggtgggtggggctt
tgctattgggttgagggctcccagcaacctgtgggacagaggttatgaaggcagagtgac
ctctgccctggcctatctgactgtatgcctgaccaccctgtgttctctcctcttgtccag
ATCACAATGAGGACCTAGGGCATCTGTCTGCTGACGCCCCCTGGCCTGCAGTGACCATGG
CCCCCCGCAAGAGGAGCCACCATGGCCTGGGCTTCCTGTGCTGCTTCGGGGGCAGTGACA
TCCCCGAAATCAACCTCCGGGACAACCACCCTCTGCAGTTCATGGAGTTCTCCAGCCCCA
TCCCGAACGCAGAGGAGCTCAACATCCGCTTTGCAGAGCTGGTG
gtcagtgagagggtggggagagacagtgacaatggggaggagggtggatggagaggcaga
gctggacagagggcagggcccctgtgctggggtctccatctctcaaaactcctcttggga
ggagataggcccccaggacacctcagctatgttggggaaccagagtctctcactgggatg
EXON 3  90 bp
gatggggctgtatctctgatagaaaaagaaatgccctatcatatctttgatgctcttcgg
gaggaagatagtagtagcctgaggaactgatttgggggaattgtaatttcctgcagggct
gactattctaatctcaaccatccctagtgtcagacgtattttttcttattgtctttgcag
GATGAATTGGATCTCACTGACAAAAACCGAGAGGCTATGTTTGCACTGCCCCCTGAGAAG
AAATGGCAGATCTACTGCAGCAAGAAGAAG
gtgccctctctgacccctctggccacatctcagggttcatggcatggggtggctcttgct
gccttggcatgctcatgcattcacctgatgtttattacatgccagccctgttctaggtgt
tggaggaacaacagtgaataaaatagaaaaaggaaattctgctgtcctggagcttacact
EXON 4  75 bp
tcatctgtatttcaccaagggagaaatggaagcctgggggagagtgtaatttcctccaac
ccacccgacatgggcagagctgagaaatgaatccctctgctgacacggaatgaagctcag
gatctcaggccacgggcctgtcttgcctgttggtccatgctgtcctttttcttgtttcag
GAGCAGGAGGACCCCAACAAGCTGGCAACCAGCTGGCCTGACTATTACATCGACCGCATC
AATTCCATGGCTGCG
gtgagtggctgcccctctcctgccctgcccccacctggaaaggctacggcagggagtgat
tcccccagcccccaccccccacacaccaaactgccttttactgctcctcagcgccccact
gcccactcactggagttcagcagctttccagttattcatgaaattttaaggtaatccacc
EXON 5  95 bp
atgaggaaagtgaagtcccagcccagaacctaggtcttcccaggggccgacactcggtct
cagtaaaccattccctgaggcctcaccctttctgaggcaagcatggcccctgggtcacac
ctgagctgtagtgcagagggttgggagacaggcagcccctttctacctgctggccctcag
ATGCAGAGTCTGTACGCGTTTGATGAGGAGGAGACGGAGATGAGGAACCAAGTCGTGGAA
GACCTGAAGACAGCCCTCCGGACACAGCCTATGAG
gtaattcagtttccccctcttgcttcctgctgagtcccttcacagttggtctccttgcct
tcccgaagccctgtgcagtgctctgctcccatgccggtcctcctggccaactctgcctca
cctgacttcacttcccagcccctactcctctcctgggaggctgccagggcttgggaggag
EXON 6  334 bp
gacacaagtcttttgtgaagatgataggatttcactgctttagataaactacgaataaac
caagtggctactgtaggtgggacaaggtgcatggtggtacacaggtaagggggtaactat
ttgcaaagtgtacacagaatcatatgcaaatatatgtttgttaatggctctgatttgtag
GTTTGTGACCCGCTTCATTGAGCTGGAGGGCTTGACCTGTCTGCTAAATTTCCTCCGGAG
CATGGACCACGCCACCTGTGAGAGCCGCATCCACACCTCACTCATTGGCTGCATCAAAGC
ATTGATGAACAACTCCCAGGGGCGGGCACATGTGCTGGCACAGCCTGAGGCCATTAGTAC
CATAGCCCAGAGCCTACGCACAGAGAACAGCAAGACCAAGGTGGCTGTGCTGGAGATCCT
GGGTGCTGTGTGCCTCGTGCCTGGTGGCCACAAGAAGGTGCTGCAGGCCATGCTGCACTA
CCAGGTGTATGCAGCAGAGCGAACCCGCTTCCAG
gtgaggggccaggctggaggtgggatgccagctgggtggggcagaggatgtcacatgtga
gtgagagcctgaagattctttgcagcagaaactgggggaaaaggaaagtaatgtggtctg
catgcctgctcctggaaggtaacaggtgaagagtactgggacctggaaggcttgcataaa
EXON 7  111 bp
ggaattttccaggcagaggtgaggtttggggcagcccagagtaaattggacagacctgat
tgggtggagagagcagatggggcattctaggtagtggaggcgacaggagtaaagatgcaa
aggccacacctgttgggaactcagccctctcctcctgctctgtcctgcatttccacctag
ACCCTGCTGAACGAGCTAGACCGAAGTCTGGGCCGGTACCGGGATGAAGTGAATCTGAAA
ACAGCCATCATGTCCTTCATCAATGCTGTCCTCAATGCTGGAGCTGGAGAG
gtggggtgccttctccttgcccttgctgttccctgactttctggacctggggtagagtgt
gtgagtgtgttgcttccccaataattgtttttgctattaaacctgggagggctcctgggg
agttgcctacataggtagcatcatgcacggtggacagacccagagctgagctggctgatg
EXON 8  104 bp
taaactaagaaataaggtctccattctttcttggaactctgggattggaagcagctccag
gtgagttagctgtgggagatgtgttgggtctgtggctagggtggtgatgagggctccact
ggggatgttgtggaaactgagatctgccaatgagtctggccctcccttggtgacccccag
GATAATCTGGAGTTCCGCCTACATCTACGGTATGAATTCCTGATGCTGGGTATACAGCCT
GTGATTGACAAGCTCCGGCAACATGAAAATGCCATCCTGGACAA
gtaagttccaagcacccgtctccattgcaaacctgtggggacagtgcctcagatggggat
agttgggacctttgtgaaggctgcccttccctctggagaccagctgccattcccagcgca
gattcagaatcagctctgtggggggaaggggtgcccttgcctgtcctctttgctgacctg
EXON 9  67 bp
cttataaagggcagacaatgggtgtcctacaaacagcggcttctttcccattttgccttc
attttgcttgaatgaagctttcagatttagccagtggggggctcgaaggggctgtaaccc
tcaaccaagggtgtgtcctggctgtaatgtctactctctctgtctccccattctgtctag
ACATTTAGACTTCTTCGAGATGGTGCGGAATGAGGATGACCTGGAGCTAGCCAGGAGGTT
TGACATG
gtgaggagccagcagggtggagcgattgcaatggggtagtagggttcttggtggccccac
agccacttttctagaccccgtgttgtggcagggctggtgtgggctggttccctggtgggc
acccccatggccaggtcctgtgatcagtcatagttcttcatagaaacacaaccaatagga
EXON 10  118 bp
tttataaaattgactatctccctgttccttttgtctttctctttttaagcctgggccaga
ggcaggggaagaaaacctttcctatgagacagggcatagtggatggaagcagggtcttct
ctctcctgctgacttcctctgctgcctacccactgatcactgtgccctcttctctcccag
GTCCACATCGACACCAAGAGTGCTTCCCAGATGTTTGAGTTGATCCACAAGAAGCTGAAG
TACACGGAGGCCTACCCCTGCCTGCTCTCTGTGCTGCACCACTGCCTGCAGATGCCCT
gtaagtaccctgcacttgctgcttccctcgactggcctgaaccttgacttggggcaggtt
tagacaagactttgggacctccctggtttggggagtctgaccatgtctccctgtgcactt
gcttttgggagggcaggccccatgacggaggcccctgcttttccttccctccttggggtc
EXON 11  139 bp
gatgactgaatcagtgagttgccattatcagcaatggcattgcctcttcttctagactgg
gagcttaccataggtggagaagggcatgcctcaccagccagaccccaggcagcaactcta
gggtggggcccaagggggacttcaggactcaggaaagatatgatacctgtcatccctcag
ACAAACGGAACGGTGGCTACTTCCAGCAGTGGCAGCTCCTGGACCGCATCCTCCAGCAGA
TTGTCCTCCAGGATGAGCGGGGTGTGGACCCTGACCTGGCTCCCTTGGAGAACTTCAATG
TCAAGAACATCGTCAACAT
gtgagcagtggccagcctttgccctgtcttcctccaccttcctcatcactctcccactct
ggtctcaccagcgaaacctcagctccctttcgcaacccagtcatcccgaaatgagtcttg
ggcagcatggtccaacagaactctctaagctaatgaaaaaagtgcatttctctactgttc
EXON 12  59 bp
tgtgaacggggcaggggacctggagagacacctgggaagtctaaatcctagcccccttga
tgtggctggacagattggagaccagggtccccacctggagggtagaaagatgatgtctcc
tgggaagctgtgaatcaatggtcaacaatcacattgccccttccctctatgccctgccag
GCTCATCAACGAGAATGAAGTGAAACAGTGGCGAGACCAGGCAGAGAAGTTCCGGAAAG
gtgaggggctctgcttaagcctgctgtccactccacatgcccttcccctgcccagcccat
aactccatgcccttccaggcagggagtcacattactcacattctctccttctgtttcctc
tcccgtcccacccccattccagaacacatggagcttgtgagccgtctggagaggaaggag
EXON 13  185 bp
gaaacagtggcgagaccaggcagagaagttccggaaaggtgaggggctctgcttaagcct
gctgtccactccacatgcccttcccctgcccagcccataactccatgcccttccaggcag
ggagtcacattactcacattctctccttctgtttcctctcccgtcccacccccattccag
AACACATGGAGCTTGTGAGCCGTCTGGAGAGGAAGGAGCGGGAATGCGAGACAAAGACAT
TGGAGAAGGAAGAGATGATGCGGACGCTGAACAAAATGAAGGACAAGCTGGCCCGGGAGT
CCCAGGAGCTGCGCCAGGCTCGGGGACAAGTGGCAGAGCTGGTAGCCCAGCTCAGTGAAC
TCTCA
gtatgcaagcatctccccctttacatagttgagccaagaccctgggcttcaggactgggt
gggcagagcaggtgtcggagaggccaaggaccccagcatgagggagaagggagatggaga
ccttgggccaggatagaagagacccttgaggctgtacaggtggcatctttgtgttagaaa
EXON 14  300 bp
ttgcgtgtgttagatgtttggatgcagagagagaaaatggggccaaatgtgtgtagaaga
taagggtaggatttggggcctagtatagaaagaaactagaaggagaggaatcatggtggg
agacctgaatggcaacggtgctgatggctttgtccttgcaatttttctgtttcctcacag
ACAGGCCCTGTATCTTCCCCACCACCCCCTGGGGGCCCACTCACCTTGTCTTCCTCAATG
ACAACCAATGACCTGCCTCCACCCCCTCCTCCTCTGCCCTTTGCCTGTTGTCCCCCTCCC
CCACCACCACCCCTTCCTCCCGGGGGACCCCCGACTCCCCCAGGTGCCCCACCTTGCCTC
GGCATGGGCCTGCCCCTCCCTCAGGACCCCTACCCCAGCAGTGACGTCCCACTCAGGAAA
AAGCGTGTCCCCCAGCCTTCTCACCCACTGAAGTCCTTCAACTGGGTGAAGCTGAATGAG

gtgagcatctgggaaggggctggagggcccattcttctacagcagggcagtcagcctcag
ggaccacccgccccttgtttacagatctccactctgggtcctttctttggtggggggtaa
gggcagtcatgtggatgtacaaagtgggtttgctgtgccaggcagctcacggtcagaaca
EXON 15  108 bp
ggagcagagtattcaagagagttggaggttgaggggagcaaccgactaccttctgaaggt
ctgaaatcctggtcatcttagtatgtgcagttgggagataagtggggttagggaggcatg
gagcatcttcatgatggagttgggccaaccatgggatcttctccctaccctgaattttag
GAGCGTGTCCCTGGCACCGTATGGAATGAGATTGATGACATGCAGGTATTTCGGATCCTG
GACCTAGAGGATTTTGAAAAGATGTTTTCAGCCTACCAGAGGCACCAG
gtaagaccctataccctctggcctcttggaccatacccttgaatccaaacctcagcttct
ccttttctttctgcctgcctgccttcctttcctttcctttccttccttcccttcctccat
cttccccttcccttccttctttccttccttcctcacatgtatactgaatgattttattct
EXON 16  107 bp
ccagataccgtctcttaaagttagctattatccaccctcctctctctcctgtctttttct
tcccccttcccctcacaccaggagcattcctggattggtaggaggtggctcttgcggggc
gggtaagaggaggattagggaacccacacctcaactgtccacttgacttgttggttgcag
AAAGAGCTGGGCTCCACTGAAGACATCTACCTGGCTTCCCGCAAGGTCAAAGAGCTGTCG
GTCATTGATGGCCGGAGGGCCCAAAACTGCATCATCCTTCTTTCCAA
gtatgtgcaaaagaaggtggttgagttggatgcctgggggacaaagggggtggaggaacg
gagtggtggcagtctcgggcctctccctctctgctgtcccctgggaggggcaggcattga
tctggaactgtctctcgggaacctgccttgagcagcagtttggggctctgcaggcaggaa
EXON 17  85 bp
tcaagtttgtggactgaatcatactagtctaatctaagaaggctttgtagaggaggtgag
gggggaatactattaaatatattcccaagtcctgttagggaatgagggaaggcggaggtg
gtaccttttggagaagaaggtttgagggctgtcctggattgaggtggggttttgccttag
GTTGAAGCTTTCTAACGAGGAGATCCGGCAGGCCATCTTGAAGATGGATGAGCAGGAGGA
CCTTGCTAAGGACATGCTGGAGCAG
gtgaggaccctcgtgggaaggaaggggaactgaacccagcgggcagccacgccccttccc
aacagcccccaggaggctgcgattcttgggtcaaggagaaatcaggctggaagagttagg
gagaaggtttatagaagcctccctgggccagcctttcttggggaaagctggaaaaggcta
EXON 18  107 bp
cagagctgtgtgccctgtcatccccttcaggcagatgaaagaaatctgtccacatgaggg
tgcctccctctttcaaggcaccctccccatcttgacccaagtcagtacagcttctcacac
cctgtaccccatgtctgctgctcaccagttgcttgtgtgacttgcgcctgctctttgcag
CTCCTCAAGTTCATCCCAGAGAAGAGTGACATTGACCTCCTGGAGGAGCACAAGCATGAA
ATTGAGCGGATGGCCCGTGCTGACCGCTTCCTCTATGAAATGAGCAG
gttgggccatgggcatggtggggattcaagcaggtggggttctggcaggtggggcaggtg
gggctctgccaagaggaaggggatggaggtgggcaggcttgagaggagactggagctggc
tccgggagctggggctggccaggataggggtgggatacctcaagatatggttcaccttgt
EXON 19  89 bp
ccatgggcatggtggggattcaagcaggtggggttctggcaggtggggcaggtggggctc
tgccaagaggaaggggatggaggtgggcaggcttgagaggagactggagctggctccggg
agctggggctggccaggataggggtgggatacctcaagatatggttcaccttgtctacag
GATTGACCACTACCAGCAGCGACTGCAAGCCCTCTTCTTCAAGAAGAAATTCCAGGAGCG
GCTGGCTGAGGCAAAGCCCAAAGTGGAAG
gtagggctgagggttgcaggaggcttagagtggagagttatctgagaaaggcagggtggg
tgggagccagtgaataggggcagagggaaacccctttcttattctcaacccaaaaacaaa
aacaaaaagtcaaagacaaaatctaaaatgatgattattataaaaatatgcacttgctta
EXON 20  169 bp
gtgggtgaatgtgaaatcgatgggtctgctgaggagtaggtataatctctgcctcactga
gagttgaaggcatttgacagccccttttctgaactttgcggtggcatcttcctggggtgc
aatgagaactgctgccctgcctagcccatgcaggcctctgacctgtgcctcctctcccag
CCATCCTGTTGGCCTCCCGGGAGCTGGTCCGCAGCAAGCGTCTTAGACAGATGCTAGAGG
TCATCCTAGCCATAGGCAACTTCATGAACAAAGGGCAGCGTGGGGGCGCCTACGGGTTCC
GGGTGGCCAGCCTCAACAAGATCGCTGACACCAAGTCCAGCATCGACAG
gtgaggacctcccttcccggccacttccttggcctctatctcaccctaccctggcctctc
acatcctccctctattaggacgggaacatcctaagactcatcacccctttctcttaacac
tccatcctctgaccctctgaccctcgtgcccagtttcctctgtcacttaccactgacctg
EXON 21  108 bp
tcccggccacttccttggcctctatctcaccctaccctggcctctcacatcctccctcta
ttaggacgggaacatcctaagactcatcacccctttctcttaacactccatcctctgacc
ctctgaccctcgtgcccagtttcctctgtcacttaccactgacctgactttcatccacag
AAACATCTCTCTGCTCCATTACCTGATCATGATCCTGGAGAAGCATTTTCCTGATATTCT
AAACATGCCTTCAGAGCTGCAACATCTTCCAGAAGCTGCCAAAGTCAA
gtgagggttctctccaagacttccttctccccatgatgaccctcattcttgtcttacttt
cctcttttggggtctactctgggcttgatgatggctggtgtgagacctcggttcttgtct
tctgagttcaaaagaatttaaacagacacacagcaaagggggtttagcatagaacaatgt
EXON 22  61 bp
agaggcatgaaggggaggtgctttgtcagggccaacatcaatggccacaccagggctgga
acccaggctcaccgactcccaggccactgtgcttggctctgccctctccctgaaccagcc
ttagcacctcaaggcgggagttgatggtcctcattcccttccctctgtgtctccttacag
CCTAGCAGAACTGGAGAAGGAGGTGGGCAACCTCAGGAGGGGCCTGAGAGCGGTGGAGGT
G
gtgagtaccttgtcagtgcctacctgggtgagggctgctgtcagcaaacactgttcgtca
ctgcaccctaagctcctacacaggggcaaaaaacaatgggtacagcctctagcacagggt
cagccctcccaaaggataactggattactggggcttaagtttgagccttttaaaaggggt
EXON 23  129 bp
gggctggctgctaatgttagctcatagtctttgccatccttagaactttgagatgcaggg
tgttccctcttccaaagggctcaatgtcctgtgagtgacgaggggagatgtggtgacccc
tgcacccgactctcatcttggcaccagtctaagcagcacttcaccctccctcctcaggag
CTGGAGTATCAGAGGCGCCAGGTACGGGAGCCCAGTGACAAGTTTGTCCCTGTCATGAGC
GACTTCATCACGGTGTCCAGCTTCAGCTTCTCCGAGCTGGAGGACCAGCTAAATGAGGCC
AGGGACAAG
gtaagggtgccccaacccccactgcttgccaacccagccttatctaaacaagctccttca
cccattcctaccacagacagcccaggagggacaaacccagagttacagagctttgagaga
aaaccgtttcttcgctcttaacaagacaagcaatgataaccacataccgcaaagatcatg
EXON 24  171 bp
cttgtctctgatcctgatgatgatgggggtgtcttctcacctcttccagccctgccccct
gtgccaacagtccccagccttgcgctgggctctgctctggctagaacccagctaacctca
ggggctgagcccagcatgctccagggcactctccaccaatcctgttctgtcccttgacag
TTCGCCAAGGCCTTGATGCACTTCGGGGAGCATGACAGCAAGATGCAGCCAGACGAATTC
TTTGGCATCTTTGATACCTTCTTGCAGGCCTTCTCAGAGGCCCGGCAGGATCTAGAGGCC
ATGAGGAGGAGGAAGGAGGAGGAGGAGCGGCGGGCGCGCATGGAAGCCATG
gtgaggggcagtgccaggcctgggactgaggggagacgggtgctacttggggagaacacc
cccaaactggggtgtgtgggaggagggcagagactgaggaactgaggaacaccatagggg
ttggatgtcagccccaggagagagaaacttcttcccagcctgagggaagagagtggtgtg
EXON 25  3060 bp
tgagggaagagagtggtgtgaagctgggggcctgtatgtcctaggcaggaagaaagtggg
gccaacagatacaggcaggcagcatgaccatggcctaggagttagcccagggttgggggg
ctgccctggcctcagcgcctctccctgagagggttcctatctttggccccccgcccgcag
CTGAAGGAGCAGAGGGAACGTGAGCGGTGGCAGCGGCAGCGGAAGGTCCTGGCTGCAGGC
AGCTCGCTGGAGGAGGGAGGAGAGTTCGATGACCTGGTGTCGGCCCTGCGCTCTGGGGAG
GTCTTCGACAAGGACTTATGCAAGCTCAAGCGCAGCCGCAAGCGATCAGGGAGCCAGGCC
CTGGAAGTTACCCGGGAGCGGGCAATAAACCGGCTAAATTATTGACCTGGGGAACTAGCC
ACACAGGAGGCCGGGAGACAGGGACTGGTGAGAATGGGGCTGAGTGGAGGAGGTGGTGAT
ATTTAAACCATTTGGTGCTTGGTTTAGAGCCTTGGGCTGGGTCCTGGGATGGGGGGCTGT
GTGTGGCTGGACCAGGTGTCTCCCCACGCTTACCTTAAGGGGCTCCTCTTATCTCCCCTT
CACATGATTCCTTCTGTGCCCTGGCCCCAGGTATTATTCTGAGGCTGCCTTGGATGGCCT
CAGGCCAGGTAACCCCAGGCTGAAGGGGCCCTGCTCCCCATCCCCTACCATGGGCACCCA
TGTGCTGGCACAGAACAGTTCCAGATCTAGACTGGAGAGGTCCACAGCCTTGTCCAGAGT
TCCTGTGTAGCACGGGGAGCAATGATGGAGGGAGCCCCTGAGAGGGAATCTGGTGAGGGA
ATCCAGACTCCCTTCTCTCAAGGGGAGGCTCAACAGAACATTGACCTGGGGGCAAACTTT
CCTCTTGAATGGGAACAGAGGAGGCATTATATATTCTAGTTAGATCAGCTCTGGTAGGTT
CCAGAGAACAGTCAATGTTGGAAGGATGATGCAGGGACCAAAGCCATCAGGACAGAGTAG
CAGTGTCTGTTTCCCATGTCACAAGTCCTCTGGCCTCTCCCTGCATGTCTTAAGTATCTT
TCCCTTCCTTCTCTACCCTCACCTCCATCCTGTCTACTAATCCACAGTCCTAGAAGACTC
ACCTTGGGTTTCCACAGCTATGGCTCACTACCAGGTGCTTGATGAATCTGGCGAGGGGCT
CAAGACAGACCTCATGCATCACCACACCTCATGCCTTTTGGGCATCTCCCATGTCCCCAT
CTCCTGGACACCTGGCCATTGTTGTGAAGCCAGACAGTGACCTCAAATGTTGCCTTGGAG
TCCCCTACAGCCCCTCAGCAGAGGGCAGCACTTGAATGCTTAGCTCCATCCCATAGTTCT
CTACTTCATATAAATTGCTCAGGCCCTCCCACCCCTTCTCTAACACTAGCTTCAAGGCAG
AAGCCACAGCAGCCTCTGTCCAGCCTGCAGGTGGCCACTTGGAACCATGTGTCCACTGGC
GTTGGGGAGTTGGTTCCTGAGAGGTCTGAGGGCCAGAGCTGCCCTCTACATTAACATGCT
GTCTCTAAGGGTGGCCCCTCCTCTCAGGCGTTCAGATGGTGCGAACAGCAGAGCAGGCAA
GGGAAACTGGGGAGATGGGGATGGAGGAGGAAGGCTGATATCCTCTGGGGAGCACATCAC
CTGAAGGTGCCAAGGAGGAAGGCTGAGAGGGGGGCCACCCCATTTCTGGTACCCAATTTG
GTTCTTCAGCCCAACTTGCAAGGGGTTCCTTCTGGTCCTCCCATCCACTGCCACCTTCCA
TTTTGTCCATCTCATGCTGGCCTTGGTGGATGGGATGGCTGTATCTAGACAAAATTTTTC
TAAAACTCCATCAAGGCTCTTATTCAATACCACGTTCCGAGTTGGCCTTTCATCTTCTTT
GAGACTGGCCCTGCCTAACCTCTACCATCAATGAGCTCTTGGCCCTTCTGCCCTTCCCTG
TGTTTCTCACTTTCCAACCTAATCCCTGGCTCAGGGTTATTGCCAGTGGAGACTGGTGAG
CTGGGCCTACTCTCAGCTGCCTATCTTCTGCCTTTCACTTGCATCCAACTCCTGGGGCTG
GGACCGTAGTAGCTGCGGGGGGGAAGAAACACAGGGTCGGTGAGCCCAGCATGTGCGTTG
GTTTGAGGGGGCGGGCGGTGTGTGTGTGTTCTGGTGGGAGGGATCTGAGCAAGTGCAAGC
CTGGCTGACACAGGTGTGAAGAGGCCATCCTGGAACCCAGGTGAGGGCAAGATGAAGGCT
TCCAGGCAGAACAGCTGCAGAGAGTTTGGCTATATGCATCTGCAGCCCCAAGAGCTCCCA
CTGCAAGACAAGTGTTGGGGAAGATGGGAGGTTGTGGGTGAGGCCTCTAAAGGTCCTCTC
CCAAACTGACCAGGCTGATGTCAACCTAACCCCCTCAGGGGCAGGGAACAGGGGAGGGCT
CCACAAGCGTGTCTGGCATTCCCACCCACCATGGAAGACTGGATACGCACCTGGAAACAA
AAGGACTATGGAAGCTGTTCAAGATACATTTGATCTTCAGAAAAGCAGAATTTGGTTCAA
CTGTTGACAGAGGACACAAATACGTTGTTCCAGAGCTCAGCCTTCTCACTCTAAAAGAAA
GATATTTTTCTATTTATTTTCTACATCTGGCCAGTGGCTCTGGTGCTAGATGCCACTGTA
GCCAGATCTCCAACAGTGCCTTGGACCATGGACTCATACTCAACTGAGTAAGAAGGGGCT
GGTGCCCAGTCGGGGTGGCTGAGCTGGTCCTTAATAGGTTGTTTCTTGGTCTTGCTTTCT
TCATGCCCTCCCCACTGCTCCTGCCACCTTTAGATAAGTTTCTCTAGCTAATTTTGTGGC
CAATGTAAAATTCGTCATCAACCTAACAAACACAACCTTCTCAGCAGCATTTCTCCCCTG
TGATGGAAATAAAGTGTTTAGGGCAGTGGGAGGAGAAAATTCTCCAGGTGAATGGGGAAG
GGTCTGTTCCAGCCTCTCCCTACTCCCATCCCATTTCCACCAACTGGGGAACTGTGACTA
TCTATCTCCCCCGACTTCTACCAGGGATGCCTTCACGCCAAGGCTGTTCTCACCAGCTGC
CTCAGATGACAAATGAGGCTAATGGACATAATCTACAGTGTCCTTTTTCACTTGCACCTT
TTTTATAAGAATATATTGTAATACTAAAAAATATTAAATTCATACCATCCCTACCCAGTC

tgcctttaaacttgtgccttcttcctatgaggggatctggggtgggctgagagtgtgctg
gagccagcttgtaccagctctgtgagaaccaattgtttacattttcagaaattttgcaag
ccatttgacatactggtagcttgaaattattcaacatgggagtatttatatcacaaattg