Gene COL21A1 Variant 1
DNA : 190.95 KbNT_007592
mRNA : 4131 bp NM_030820
CDS : 2869 bp NP_110447
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  158 bp
tgaactgagtgtttccaccagggcgacactagcagttcgcccttcaagatccagatccaa
aatccaccctctggtcttcggccaaggaaagggggcgggtggggagcgcgaaccttatct
cccgggctccgcctccagggggctgagagcgagtttctgagcctctgagctctgcactgg
CCGCTGCAGGGAGAACGGACTCCGGGCGGAGGGCAGCCAATCCGTTTCAGCGCAGGTCTT
GCTCGGGTTGGGCTTGCCACTGCCTGGAACATACCTGTCCCCCTGGCGCAACACTCAGCT
GGCTGCGACGGCAACCCCGAGCCTGGACACTGCGCCAG
gtaaggagacacctcctactcccctctcgctgccagaatgacatctcggggggcctcagg
gctggctctccaggggctgcaatttggcattttgggtttcctgggggtgcagtcttctcc
ctgcgccaaagcagttggtgaactgttcggtgaattccgcgcccagctggaggctgagat
EXON 2  126 bp
attcattgtcctcctgcattaatatatttaacatttggctgttttaaacagatttaagtt
aattctaatagtcacaaaattagctgtacttcaattggctcttgtttcaaaatgtaaatg
tataatggctagatgttgactttaattaatatatttaacttgccttttttttccccctag
GAATCCTAAAACCAAAATATTAGAACGAAAACAGAAACATGGCTCACTATATTACATTTC
TCTGCATGGTTTTGGTGCTGCTTCTTCAGAATTCTGTGTTAGCTGAAGATGGGGAAGTAA
GATCAA
gtaagaactatcagcattgtccttttttgttatcaacaaattaatctggaaattaaacta
ggggagttcaagtaatggttttaaggatctcattcttactgtctttgattctgtaactcc
ctaaaataaatgaattgctatgttactcattaactgagaagaaaagcttccctcagagat
EXON 3  552 bp
ccctattcactggcttatatttttgtaatatttcacgttagcattaagctaaacatattt
cacagacaatttaaaataagcaatgatattagtgtatagctgaaactcatatatttaaaa
tctctccctttttgctttttatataaaagatgtgctatgatggttttcttttgcacttag
GTTGTCGTACTGCTCCGACAGATTTAGTTTTCATCTTAGATGGCTCTTATAGTGTTGGCC
CAGAAAACTTTGAAATAGTGAAAAAGTGGCTTGTCAATATCACAAAAAACTTTGACATAG
GGCCGAAGTTTATTCAAGTTGGAGTGGTTCAATATAGTGACTACCCTGTGCTGGAGATTC
CTCTCGGAAGCTATGATTCAGGAGAACATTTGACGGCAGCAGTGGAATCCATACTCTACT
TAGGAGGAAACACAAAGACAGGGAAGGCCATCCAGTTTGCGCTCGATTACCTTTTTGCCA
AGTCCTCACGATTTCTGACTAAGATAGCAGTGGTACTTACGGATGGCAAATCCCAAGATG
ACGTCAAGGATGCAGCTCAAGCAGCAAGAGATAGTAAGATAACATTATTTGCTATTGGTG
TTGGTTCAGAAACAGAAGATGCCGAACTTAGAGCTATTGCCAACAAGCCTTCGTCTACTT
ATGTGTTTTATGTGGAAGACTATATTGCAATATCCAAAATAAGGGAAGTGATGAAGCAGA
AACTTTGTGAAG
gtaagccttaaaatgccttaatataatttggaagcaattaataattgtgctttttacatt
ttgatataatttcttcattaacactggtgtaaattgttatatttaatgtcaattataatg
ttacaacatttataatgttataaatgttatatttatactgtgagcataaattttttgtgt
EXON 4  169 bp
cttctacattttctcagaaaatgtattcatatacatttatatactatacatttgtataca
tatgtagattttataattctaatgatagaatactatattgtctagtatttctcccttgat
ttttcttttattgtttgaatagtccatgattaaccaacttttattgcttttgctttatag
AATCTGTCTGTCCAACACGAATTCCAGTGGCAGCTCGTGATGAAAGGGGATTTGATATTC
TTTTAGGTTTAGATGTAAATAAAAAGGTTAAGAAAAGAATACAGCTTTCACCAAAAAAGA
TAAAAGGATATGAAGTAACATCAAAAGTTGATTTATCAGAACTCACAAG
gtatgcattatatgttgacacaacttttttggggggatatgtctgtggacatgtcaagaa
ttctttaagcttacacttgctcttctttttctagcaatgttttcccagaaggtcttcctc
catcatatgtatttgtgtctactcaaagatttaaagtcaagaaaatttgggatttatgga
EXON 5  217 bp
aaggttaagaaaagaatacagctttcaccaaaaaagataaaaggatatgaagtaacatca
aaagttgatttatcagaactcacaaggtatgcattatatgttgacacaacttttttgggg
ggatatgtctgtggacatgtcaagaattctttaagcttacacttgctcttctttttctag
CAATGTTTTCCCAGAAGGTCTTCCTCCATCATATGTATTTGTGTCTACTCAAAGATTTAA
AGTCAAGAAAATTTGGGATTTATGGAGAATATTAACTATTGATGGAAGGCCACAAATAGC
AGTTACCTTAAATGGTGTGGACAAAATCTTATTATTTACAACAACCAGCGTAATTAATGG
CTCACAAGTGGTTACCTTTGCTAACCCTCAAGTTAAG
gtaaagatgcctgggataataccatgattatgatattcatggggaagcactattgggttt
atgtgtgttggggaaaagagggctataattttaacatgattggaaatatttttactttaa
attttaatgtttctgtgttgaagaaaactaacaaagaaaggaaaattgtttcttgatcaa
EXON 6  174 bp
aaagaattggtggatagcatatgaggtccaccttggatcagggtgaattaatgtataata
cagtcagtctgtgtgggatgaagtttctcagcaatggttaggaacaagggagtaagaaca
aagaaaataaaatattgttaggggctttatttatgaatcttccacactttctttttgtag
ACGTTGTTTGATGAAGGCTGGCACCAAATTCGTCTCTTAGTAACAGAACAAGATGTGACT
TTGTATATTGATGACCAACAAATTGAAAACAAGCCCTTACATCCAGTTTTAGGGATCTTG
ATCAATGGGCAAACCCAAATTGGAAAATATTCTGGAAAAGAAGAAACTGTTCAG
gtagataaataatgatttactctttgaattatatagaatgaaacttttgctgtcctttgt
aatagttttcaccacatttaatcatatttaacatacttatgaattcccttaagttgttca
ccaaaatgtggtcagttcattagtgaaattatgcatatgtatatgtattaaaatgcagaa
EXON 7  82 bp
gcatcacatctttacagtgtaaagtattaaaattttgtattttcattgttttagctaaat
gctgtgatgtaaaccttacacaattactaaccatagtggatgtttctatgtatctgagtt
gctcttataaaacaattagcttgtgcctcaactttaattctactgggtttatgttcttag
TTTGATGTCCAAAAGTTGCGAATCTACTGTGACCCAGAACAGAACAACCGGGAGACAGCA
TGTGAGATTCCTGGATTTGTAA
gtaggagggattgtttttttcccagatgttgctttagtactttcaaagcaataaataaaa
agcagatactatctgagtattaatttaatatgtagacttaattttattttttaatgttag
tggaagtgaagttacatgaagcaaaacatattttgaggttataattgaaatgagattgtt
EXON 8  84 bp
ttaatatttatagatttttgtgatttggaatttcctattgggttgggttagataaaattt
gaaagtgaatgtaagatatttttgccattttacacaaatatataaatgcataaacatacg
tgtgcatgtacttatatgtctttccatgcttgttgtctgtttccatttttgtctttatag
TGCCTTAATGGTCCCAGTGATGTAGGTTCAACTCCAGCTCCCTGTATTTGTCCTCCGGGA
AAACCAGGACTTCAAGGCCCCAAA
gtgggtaacacctaacttgctgtttttgttaaaacacacaaacaagagctgggtaaacca
tacaattcctaatcaccattgatcctgttgagaaatttctatctgatttcttatagagtt
taaaacctcagttttagtcattttttttctagaaaaacaagtgtattctagcctagatta
EXON 9  63 bp
gtataataaaatgcattatttattaagtaagcatttaaaatatggctttttttttttact
tttgtttttaacatacaaaaaacctcaaataatggaattggttttgaacttttattgatc
ctgactgcaccaatgtggctggttgttttgtactcaaaagtttgtttgcttcctgcttag
GGTGACCCTGGACTGCCTGGGAACCCTGGCTACCCTGGACAACCTGGTCAAGATGGTAAG
CCT
gtgagtactgaaagcttagtcatctccggtatatctgggattacagtgtcaaagtaaaag
ttttgctgagcaaatctaaacagacaaggaaagctttattcatgactgctgccataggaa
ggagagactgaactcaactctgttggaacgaaaggagctagggtgtgtgagcactaggac
EXON 10  54 bp
cataaagatcaaagggtatgaattccttattaagcatttaacactttattattttggatt
tgtctctaagtgaagttttaggcatgagaaacttgagataagagtgaattctgaaacgaa
gaacttctcttggtaaatatgatgaaatattattttttttctttttaaatttttctttag
GGATATCAGGGAATTGCAGGGACACCAGGTGTTCCAGGATCTCCAGGAATACAA
gtatgtgatccacttatatacattttataaattttatttttagtgaactaaaaccgataa
ttaacaaaattttattttctggttaatttagggagctcgaggactaccaggttacaaagg
agaaccagggcgagatggtgacaaggtaaacacacacaaaaatgcaatcaatggtgttag
EXON 11  54 bp
aatattattttttttctttttaaatttttctttagggatatcagggaattgcagggacac
caggtgttccaggatctccaggaatacaagtatgtgatccacttatatacattttataaa
ttttatttttagtgaactaaaaccgataattaacaaaattttattttctggttaatttag
GGAGCTCGAGGACTACCAGGTTACAAAGGAGAACCAGGGCGAGATGGTGACAAG
gtaaacacacacaaaaatgcaatcaatggtgttagtccctcaaagataaaggatgttagc
tgtgatggtttccattcaatagtctgcgtcttggtgaattctaagatttgtgggctcaga
aatttgtcagtggctattagacaataaagcttatagaaggctttatcactacataaaaga
EXON 12  54 bp
aatgaaaccctgaaaagtagggataatttttcatagagataattgaatgctgatatgaaa
ttaactgtttgcagatagatttgaagtggattttgacaagggtgaggttgaagaatagat
gatgatattgtttaggctggaatggtttttctttgtaattaatttcagttttattttcag
GGTGATCGTGGACTTCCTGGTTTTCCTGGGCTTCATGGCATGCCAGGATCAAAG
gttgaagaaatctgtttcttttaaatatagcaaagccattttttaattcaaatataaagt
acttttatattacaaatatgttataaataaatgttcatatataattagagataaagtaaa
caatgggctaagattaatattagtttatataaaactttacaaaattccctttaaagtttc
EXON 13  54 bp
taaatttttctttataaagcctggaaatgagggccttttaaagcaaactttaaattattt
tatttctattttgttttgcttttggcatattaaactcttttgcttataatctgtattttt
tctttataagaaaaatattcatatttcttaaatattcactatttatattttgtcttttag
GGTGAAATGGGTGCCAAAGGAGACAAAGGATCACCTGGATTTTATGGCAAAAAG
ggaagtatagatcacacaacaaagtattcatattgaacttttaatgtaatggaaacagaa
aactagaattgcagttctaacccagcattagaacagttagctctgttcacccttcttagg
ggattaattcagaacaatgaaaaaagaaaaaaaagaaaaaaagagctggtgactgcagac
EXON 14  54 bp
tcttgatattgcatccactgggttggtaaaatagtgctttgcagagtcaacatgagttgt
agttccatgagtttttactacataatgatgttaacttagtagcttttctatttaagtttt
ggttggaacttgaaaacattattgtaaagattgtgttttaagtgtttgttttcgatacag
GGTGCAAAAGGTGAAAAGGGGAATGCTGGCTTCCCTGGCCTCCCTGGACCTGCT
gtgagtttgatagaaaaaagctcttagtattttgctttaaataaaatctatcttatagta
tctgtctttaaagagaaaaaattagtgcaaaaatatattaaagcatatgtatttattttt
tagggagaaccaggaagacatggaaaggatggattaatgggtagtcccggtttcaaggta
EXON 15  54 bp
cagggtgcaaaaggtgaaaaggggaatgctggcttccctggcctccctggacctgctgtg
agtttgatagaaaaaagctcttagtattttgctttaaataaaatctatcttatagtatct
gtctttaaagagaaaaaattagtgcaaaaatatattaaagcatatgtatttattttttag
GGAGAACCAGGAAGACATGGAAAGGATGGATTAATGGGTAGTCCCGGTTTCAAG
gtatttataaaaaaaaaaaaaaggacaaaacaaaaagatttttgtatcttgagaggaaac
ataagaaaaatgtaccaatattaaaattttttaacatgtggcattgggataaaattcatg
agctaaaaggttttttacgtgtaatttaaaaatgctactgaatttcttttgactttattg
EXON 16  54 bp
tttatgaatttctgaaaaagttatttgatgtcaggaaaagttaatatcagtagtccagaa
gtaattttaatttttctgtttgtatttaatgttctttaatatgtaatgttatatattgtt
attttggtaagcagacctcaaaactgaattctctatttctttttgtcaaatcattaaaag
GGAGAAGCAGGATCCCCTGGTGCTCCGGGGCAGGATGGAACACGGGGAGAGCCT
gtgagtaccttctcatttcagttctaaaagatgaagttcttttcctgttacgaaatcctt
tttggttatttaaattcttctctcagatgccctattatttgttcagtgacttccagattt
tagatgttgtagaagctgcttgtgaaacaccataaaatattgaaatgttgaatcctcttt
EXON 17  45 bp
aatgctatatctcctaagttgtcttttccatattggattattacaaatagcaatattata
atatgtatacatttgaaaatatgttatttaccagttaaaattccaattgtgactgtttct
tctttaatgataaagtcttcaattttttataagttaaaaatctattttatttgtttttag
GGAATCCCAGGATTTCCTGGAAACCGAGGATTAATGGGCCAAAAG
gtaagtattcatgagagttagctttgggcctggatctgctcatttaatgcattgttgtct
acaataaaatacagttttacatttgtggtaacagttaatttttcaaatattatataattt
tagaagacgttgttttggctttacaaatttgtatatattgttttgtggttgttttatata
EXON 18  54 bp
ctcagactctatgccaaggtctttaaggccttgctccttccttactgtagtggaagagaa
agcagaaaaaggtgaactgattgatattcaattgtcattccattgtgctttggcagaagc
tttcttgaaataaattgataatttacaatttataatgtttttaatgtttgatttttttag
GGAGAAATTGGGCCTCCAGGACAGCAAGGAAAAAAAGGAGCCCCAGGGATGCCT
gtatgttgatgtcattatcatcatacatcaaagtgtttgcagtgttgctactacctacta
ggagttcatattcgagagttcataaaaatgtaggggatacagcaataaaatatttgaggt
ccatgaattccattctgttgtatgaaacatattatgtctatgtgcatttttctaaaagag
EXON 19  54 bp
ttacttttattatcctctatggatgtatggtggagtaattttctaaatattgtattatat
tttcagatctgtattataatttagtgaattaattatgagaatgtgtaacttggaaattga
tttaatattttttaataatcttctctaagttactcttgaaattcctttttaaaattgtag
GGTTTAATGGGAAGCAATGGCTCACCAGGCCAGCCTGGAACACCGGGATCTAAG
gtaaatatgataaaataaacaagactgggaactttgtataatcacagtggccatttataa
ctttgatgaaaattttactactaccttgattgtattttaaatgtggtttttattctatga
aaaaaaatcacttgtaagaattaaatctggaaaggctcagcctaagaaacaggctaaagt
EXON 20  54 bp
cttgcctaaaagattttttcatttttcttaatacataggtctaatgtacagagtctatca
aacaatcggaaagttaaaaatgtaaaagttattttacatatattcccttaagtgtctata
tcagatatattatgacagaattgtttttaaaaaactccaatgtttttgatgtgttgacag
GGAAGCAAAGGTGAACCTGGAATTCAAGGGATGCCTGGGGCTTCTGGGCTCAAG
gtaattttgatgcatttgaaaatattttcaaagaaattataatgtaaattcccctcatta
tttaagaaaattaacattttatatctctgaagagatacatgaagttaaggattaccttta
tcatgaaattaaggtacctgaaatgaaattgtcaatacagtttcatttctgttttttaga
EXON 21  72 bp
atacaagaaattttactgggattctagtaaacattttattctttactatttctgtagtag
taactgtcaatacatttttttaaccattcattttaaaattgagatatgtagagataaaaa
cagtggtgcttttcataagcagtagatctgtgatctttctggaatttctgtgttacatag
GGAGAACCAGGAGCAACGGGTTCCCCAGGAGAACCAGGATACATGGGTTTACCCGGGATT
CAAGGAAAAAAG
gtatgcattggttaggagatacagttcgcttttaaccagttacttgcaaacaagtttttc
ttttgtgaaattcttaaagtaggacttgttattaatatatttttaatgataaagtaccct
atatattcgatgtatgtataatatgttcagccccatgctaatagctgtggcatcttttat
EXON 22  36 bp
tgacataatgtggttctgctcccttcccaagtattgtgttaggagtcaacttctgtgtat
acaggcacttgtggagtttgcacgagatgttgtttttcttcagcagagaaaaatatatgt
ttatttgaaactgtacagaatatgctagattatgatacagatcaaactgcctttttgtag
GGGGACAAAGGAAATCAAGGTGAAAAAGGTATTCAG
gtatgttgtttgcttttttttagtaggctgagcaataaaatcagagcttttaaaaagttc
ttattttacttttaaattcctttctgtttcaacattaatataaagttgttaaatcctatt
ttctccttttgctattgagcttttcagacaagaccaaatttgactttaaaattcctcacc
EXON 23  45 bp
cttttcttcttctttttcgctgagtaactgattttcccatctctcacataatttatatat
ttgtatcgctgcttttgttacgtttcttctggaactcaaggtaatacatagtttgtattg
catatgtgattgcatcgtaagtgtgcaaactaatcaataatgtttttttttattttaaag
GGTCAAAAGGGAGAAAATGGAAGACAGGGAATTCCAGGGCAACAG
gtattttttggttttcttctgataaaaaatgaaataacaagtcacataactggacaatgc
tgagagaggattacttgcaaataaaaatgggtggggagaaggacaatatagtatgcattc
taagcatataaggttgaacatgtaggtagtgtggtgataatgagtttctttcattatttg
EXON 24  33 bp
tatttcctagtcattagccttctctaaaaggcaaaaagggtctgtaattctgtcactaat
gctatcaatattttccaaattgaaattttaaatttaattaagtatgtggtaaaaggtgga
tgccacattacagtactgtagcttgcacatttattatattttttctattaattttcaaag
GGAATTCAAGGCCATCATGGTGCAAAAGGAGAG
gtatgtttcttcatatattatgctctcttgctctctttcttcggtcctttttgcttgggt
ttcaatactatataaatctagcttttgagtaaaaaccagaaaacgaaatgtttttcatct
tcttcagtagaagttcccaattaattgttttcagaatatgtacatttatactgaatttga
EXON 25  147 bp
cagtttaatatgacatgaaatttcccttctggtcaatgacaatatttccggctattcctt
acataccttacatatttacatatgtatacatgcatattcacatccttaacgagcttcatg
atgcaattatacctcctgaaatatttaaatagaacttgtaaagatttcttttgcttttag
AGAGGTGAAAAGGGAGAACCTGGTGTCCGAGGTGCCATTGGATCAAAAGGAGAATCTGGG
GTGGATGGCTTGATGGGGCCCGCAGGTCCTAAGGGGCAACCTGGGGATCCAGGTCCTCAG
GGACCCCCAGGTTTGGATGGGAAGCCC
gtatgtattctgcttctttcacagttattacattttcattgatttttgctcatgttcttt
atgtgcatgttataacccctaacactttgatgcagggaagagagttttcagaacaattta
ttcgacaagtttgcacagatgtaataagaggtaggtatcaaatatagcattttaataact
EXON 26  55 bp
ggatggcttgatggggcccgcaggtcctaaggggcaacctggggatccaggtcctcaggg
acccccaggtttggatgggaagcccgtatgtattctgcttctttcacagttattacattt
tcattgatttttgctcatgttctttatgtgcatgttataacccctaacactttgatgcag
GGAAGAGAGTTTTCAGAACAATTTATTCGACAAGTTTGCACAGATGTAATAAGAG
gtaggtatcaaatatagcattttaataacttttctcaaattacaaaagtaatacaaattc
ttaggacatattgtagaggatataagtgaggtgaagaagaaaacagataacatttataag
cctcatctacttttcttcaatgagtatttttataaagatttatcatatatactcttttat
EXON 27  201 bp
accgcacagagcaatgaatatttccatagtcaaattcctagaagtgaaattattggccaa
gaaatatgcacatattcaatgttcgtagttttttctctgtaaactgaaaaaaattaaaaa
tataattaacaccaactcaccatttaaacataagggatggggtttctttgtttttgaaag
CCCAGCTACCAGTCTTACTTCAGAGTGGAAGAATTAGAAATTGTGATCATTGCCTGTCCC
AACATGGCTCCCCGGGTATTCCTGGGCCACCTGGTCCGATAGGCCCAGAGGGTCCCAGAG
GATTACCTGGTTTGCCAGGAAGAGATGGTGTTCCTGGATTAGTGGGTGTCCCTGGACGTC
CAGGTGTCAGAGGATTAAAAG
gtatgcagttagtttcaacaagaaaatgaattttaaaaagtctttttttaaaaattcata
ccctatatccatttaatagtcgagttaacttttttcatgataaaaaaatctgtaaatgct
cgtctttaaataatttgccaactgaattaaagagaaattattttcttaatgcaatattct
EXON 28  78 bp
ccactgatcattttagaaattattgcttcaaaacttgttttccattagtaagaaaaaata
gatggcaagctggtttttaaaagacatttttctttcatgtgtatattaacagctttgaat
gaaacaatctagaaggcagtgattttaagtaaacttactcagatgtttgacaccctgcag
GCCTACCAGGAAGAAATGGGGAAAAAGGGAGCCAAGGGTTTGGGTATCCTGGAGAACAAG
GTCCTCCTGGTCCCCCAG
gtgagaattgctacctgctcataagtgttactgctcattttgctttaagaaaagtcatca
tagatctatgtgaaataaattgaaactgagacatctgttttcttttttgagtgattcaca
tttaacacactgaagtctaacttctggaatattttttcatatattatcctcaatttatga
EXON 29  1254 bp
ggttcttttcaaagcagaagacatgtagaattatcaagaaaatgcctctactatataatt
agtgcaaatatataaaatattcaaggttttttttttcagtttaagtttcttgcagaattg
gctatttcattataaaaaactaaagtcctctgtttacgtcttgccaatgtcccatcttag
GTCCAGAGGGCCCTCCTGGAATAAGCAAAGAAGGTCCTCCAGGAGACCCAGGTCTCCCTG
GCAAAGATGGAGACCATGGAAAACCTGGAATCCAAGGGCAACCAGGCCCCCCAGGCATCT
GCGACCCATCACTATGTTTTAGTGTAATTGCCAGAAGAGATCCGTTCAGAAAAGGACCAA
ACTATTAGTGTCTGATGCCTCATTCAGCAGCCTAGGCATGGTGCTTTTTCTGTGGTCTTT
TGCATCTCAGGAAGATAACCAACAGTAATCCCTTGAAAAGAAACTTAAGTACCTCGGTGT
TTTTATTTTTTTTTTCTTATGGAAAAAAATATAAAAGATCACATATACTGATTTTAAAGG
CTCCTCAGTCATTTGGAGCCCTTGGATTAGCAGCATTAATTAAATCTCAAGGGTTTCTTG
TAAAGTCCATTTATGTTAATCAAAGTTGAATATAAAAATCCACCATTGCCTGTTAGCCAG
TCAGTTTTAGTCACTGTGAAATATTTCACATTCAGCCTCCATGCAGTAGAGATTTGAGTT
TAATTTCATGTCCATGTGACTTTCATGTTTCCTATCTCATAGCTCATGCTACTACATAAG
CCAAAACATGTATCTCATCATTGGAAGTAAGATCAGGGCTGATATTCACCTGGGATAGAC
AGTATTGGTGAACTACTCATTTACTACAGTGTCTCAGCCTTGATAAGGGGCAGTGGATTG
CCTGTTGTTCGGTGTTGTGAATAGCACCTCTGAATAAGATTAGAGTGTTTCTTAATTCAT
TTCAAACTCTAAAATTAGATTAATGGTGGTGCTAAGAAAGAGTATTAATTACTTTGGGAA
TGGTCAAAATTAACATTAAAAACATTTTAGACAAAAAGTTTCATTGTACATTCAAAGAAA
ATGTAAGTTTGGAAGTACTAAAAGACTATTTTATACTTGTTGATTAATCGGAATGTTTGT
TGTATGCCTTCATTTTCCATTTCACTTATATGTGTATGTCCATATATGTTAATTTTCATT
GTAGCAAAGCTAATGGAAATAAAGCTAATGCTCTAGTTGAAAGAAAAGGAAAACTCCTGA
AATCCTAGAATGTCTTGTTATTTTTAGCTGACTGTAAAATATTATGAACAGTCTTTGTGT
ATTGTGCTTAATGCTTTTGTAAGAAACAGAATTTGAAATATTTCATCCTTGTCATGCTCA
AAATTTTGTTACATGCTTGTTATTCAGAGTATAATAAAGTTTTGTACAGGCCTG
attacaatgtctttttttatacctaattttaactgattgttgagtatggtatgtatattg
catggtcatttattcaatggatataatttatgaaatcattcagcctattcttaaaaaatg
tgttcacctgaaataagaaattacaaattgaattggtgtgctacacacctgaacagttga