Gene CDSN Variant 1
DNA : 4.84 KbNT_007592
mRNA : 2042 bp NM_001264
CDS : 459 bp NP_054787
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  99 bp
tgctgctgagtaggcagatgcaccgggctgattaccacgctcctcccggccacaccaact
tcccccggggcacccaccccctccacctctcctcctctccccacagtgactcctgcccag
ggaatgtccagctctggcataaaggacccaggtgtcctcgagctgccatcagtcaggagg
CCGTGCAGCCCGAGATGGGCTCGTCTCGGGCACCCTGGATGGGGCGTGTGGGTGGGCACG
GGATGATGGCACTGCTGCTGGCTGGTCTCCTCCTGCCAG
gtaggaggctgggggccctgggaacaggagggaggcgggagggagactccgggagaggac
ccagcgaaggggacgggcaggggctctggaatctgccttttgagtctgggggttgctcct
cactgtatggtcgcctcaggtaagtttcttaaacttcctgagccccagtttctgaaattc
EXON 2  1943 bp
ttcggccacctcaatatcctttagagacaatagccagttcttcctcctttctccatccct
aaactctccctgcgctctgcttgggagaaacccgagaggccgattactgagataaggcag
aaaggtgagggaggaagccaagcctctttggcccttactaaccactgctttcctccacag
GGACCTTGGCTAAGAGCATTGGCACCTTCTCAGACCCCTGTAAGGACCCCACGCGTATCA
CCTCCCCTAACGACCCCTGCCTCACTGGGAAGGGTGACTCCAGCGGCTTCAGTAGCTACA
GTGGCTCCAGCAGTTCTGGCAGCTCCATTTCCAGTGCCAGAAGCTCTGGTGGTGGCTCCA
GTGGTAGCTCCAGCGGATCCAGCATTGCCCAGGGTGGTTCTGCAGGATCTTTTAAGCCAG
GAACGGGGTATTCCCAGGTCAGCTACTCCTCCGGATCTGGCTCTAGTCTACAAGGTGCAT
CCGGTTCCTCCCAGCTGGGGAGCAGCAGCTCTCACTCGGGAAGCAGCGGCTCTCACTCGG
GAAGCAGCAGCTCTCATTCGAGCAGCAGCAGCAGCTTTCAGTTCAGCAGCAGCAGCTTCC
AAGTAGGGAATGGCTCTGCTCTGCCAACCAATGACAACTCTTACCGCGGAATACTAAACC
CTTCCCAGCCTGGACAAAGCTCTTCCTCTTCCCAAACCTCTGGGGTATCCAGCAGTGGCC
AAAGCGTCAGCTCCAACCAGCGTCCCTGTAGTTCGGACATCCCCGACTCTCCCTGCAGTG
GAGGGCCCATCGTCTCGCACTCTGGCCCCTACATCCCCAGCTCCCACTCTGTGTCAGGGG
GTCAGAGGCCTGTGGTGGTGGTGGTGGACCAGCACGGTTCTGGTGCCCCTGGAGTGGTTC
AAGGTCCCCCCTGTAGCAATGGTGGCCTTCCAGGCAAGCCCTGTCCCCCAATCACCTCTG
TAGACAAATCCTATGGTGGCTACGAGGTGGTGGGTGGCTCCTCTGACAGTTATCTGGTTC
CAGGCATGACCTACAGTAAGGGTAAAATCTATCCTGTGGGCTACTTCACCAAAGAGAACC
CTGTGAAAGGCTCTCCAGGGGTCCCTTCCTTTGCAGCTGGGCCCCCCATCTCTGAGGGCA
AATACTTCTCCAGCAACCCCATCATCCCCAGCCAGTCGGCAGCTTCCTCGGCCATTGCGT
TCCAGCCAGTGGGGACTGGTGGGGTCCAGCTCTGTGGAGGCGGCTCCACGGGCTCCAAGG
GACCCTGCTCTCCCTCCAGTTCTCGAGTCCCCAGCAGTTCTAGCATTTCCAGCAGCTCCG
GTTCACCCTACCATCCCTGCGGCAGTGCTTCCCAGAGCCCCTGCTCCCCACCAGGCACCG
GCTCCTTCAGCAGCAGCTCCAGTTCCCAATCGAGTGGCAAAATCATCCTTCAGCCTTGTG
GCAGCAAGTCCAGCTCTTCTGGTCACCCTTGCATGTCTGTCTCCTCCTTGACACTGACTG
GGGGCCCCGATGGCTCTCCCCATCCTGATCCCTCCGCTGGTGCCAAGCCCTGTGGCTCCA
GCAGTGCTGGAAAGATCCCCTGCCGCTCCATCCGGGATATCCTAGCCCAAGTGAAGCCTC
TGGGGCCCCAGCTAGCTGACCCTGAAGTTTTCCTACCCCAAGGAGAGTTACTCGACAGTC
CATAAGTCAACTGTTGTGTGTGTGCATGCCTTGGGCACAAACAAGCACATACACTATATC
CCATATGGGAGAAGGCCAGTGCCCAGGCATAGGGTTAGCTCAGTTTCCCTCCTTCCCAAA
AGAGTGGTTCTGCTTTCTCTACTACCCTAAGGTTGCAGACTCTCTCTTATCACCCCTTCC
TCCTTCCTCTTCTCAAAATGGTAGATTCAAAGCTCCTCTCTTGATTCTCTCCTACTGTTT
AAATTCCCATTCCACCACAGTGCCCCTCAGCCAGATCACCACCCCTTACAATTCCCTCTA
CTGTGTTGAAATGGTCCATTGAGTAACACCCCCATCACCTTCTCAACTGGGAAACCCCTG
AAATGCTCTCAGAGCACCTCTGACGCCTGAAGAAGTTATACCTTCCTCTTCCCCTTTACC
AAATAAAGCAAAGTCAAACCATC
atctggaaacagtggccacttttcactgacctctcttcgacatctagtcaacccacccaa
tatgccactgggctttcgctcccaattccaccccaccctccattacagagctcaccacgc
cctcctagatcaccgtccccaacacacccattgcctctcaaggcccttatctcagcccct