Gene CDC5L Variant 1
DNA : 59.48 KbNT_007592
mRNA : 2999 bp NM_001253
CDS : 2409 bp NP_001244
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  304 bp
acaaagccttcttcggagcaactgtgctgaaattccgtacgcgtgacgttcccaccctct
gccactcggtgacgtcacgatcaatcccaccactaagttcccagccaagcgctaccgccg
ctatctcgcgagagccgtagtttcttccattctgttttggacatgcgcggggcgtaaggc
GCTTTGGCCAGAGTGGTTTGATGGTTTTGTGTTAGTCTTCCTGCAGCTGAGCTTCCACAA
GACACTTTTTCCCTTTCAGCCACCCAATATCTCGCGAGACTTGCTATTCTGCGCCCCCTC
CCACCTTGCGCTTGCGCAGATCTTCAAAGCAGAAGGTCGCGCTTGGAGGAAGTGGCGGCT
TTGAGTCCGGTGGCCCAATCGCTGTTACTACTTCTCTGAAGCTCCTCTCGGCTGCTTGCC
GAGACACCCTGCCGCCAAGATGCCTCGAATTATGATCAAGGGGGGCGTATGGAGGAATAC
CGAG
gtaagtctccttttcccgccgtccgctgcccgccgctccctctagcagcttgtgcgcacg
cgcgcggaggtcgggggggcgacgaggagaccctgtggggtctgcgtggagggcagcccg
ggggctgacccttggggccctttccgtgtgtctggccccgtgttgtgcgagcgccagtag
EXON 2  104 bp
attcttggttgctgttattatagttaatgaggttttcatccttagtcttttaacctaggt
ggtgtgtatgtgcatgttatatgtctctttctccaatagccctatcagagttaatttaaa
ttttgtcttttcccacttggagttttgtgactgaatgtactctttggcaattttttttag
GATGAAATTCTGAAAGCAGCGGTAATGAAATATGGGAAAAATCAGTGGTCTAGGATTGCC
TCATTGCTGCATAGAAAATCAGCAAAGCAGTGCAAAGCCAGATG
gtatgtatcagtttaataagtggaaaacagaaaaggagcttaattatgatgatggaaaat
gtcaactctgtgaaccttatcaaagaaagcagacattgtaatataacaaggcatggagtg
ggagatggaagttgggtgtttgacttagctgtcacttgcttcctgtgtggtcttaggcaa
EXON 3  162 bp
aatgtgatgagatggggaatattgactggggtaagtgtaaccacacagcaaatattctgt
tgtcaaaaagaacagtttttgtaattgaaggatgagagcacaagtcagtgtatccattgt
gcaaattggatatttatgccaggtaactgattaatatataaaatgatctatgtttaatag
GTATGAATGGCTGGATCCAAGCATTAAGAAGACAGAATGGTCCAGAGAAGAAGAGGAAAA
ACTCTTGCACTTGGCCAAGTTGATGCCAACTCAGTGGAGGACCATTGCTCCAATCATTGG
AAGAACAGCGGCCCAGTGCTTAGAACACTATGAATTTCTTCT
gtaagtgagtcttcagaaagagcatagaatatatgtatatgttctgaaagaggctgaata
aactttgagtattttctgtctttaaacttttaattatggatgtgagtaaacccaaagcta
aagccattggataatattttccatatctcagatggttgatcaaaattatgccttctgtca
EXON 4  128 bp
gaaatcagcaaattttaatatcatttctttcagatgaagtgatagtaaaaaggctttatg
ttgttaaagcccatccattggtttttttggggggaaaaatatcgtcagaacttggaaatc
tggtaattttaactctaaatggtactgtagtgtgactaactcctatgggcttttttctag
GGATAAAGCTGCCCAAAGAGACAATGAAGAGGAAACAACAGATGATCCACGAAAACTTAA
ACCTGGAGAAATAGATCCAAATCCAGAAACAAAACCAGCGCGGCCTGATCCAATTGATAT
GGATGAGG
gtaagtgtatgctttgaggaatttatttctttggtaactgtaaactccttgggcctcact
cttttagttcctttctgaactcctctactttagaatcccttttttttttgagacaaggtc
ttgctctgttacccaggctggaatgaagtggcacaatcatggttcactgcggttttgacc
EXON 5  100 bp
gtttttaacctaggttctttgacttcaaaactcaagctgtttccattatgctacaccata
aaatcagtatttttatgtttttttctcattttgagcaatagagtgtctcttacatacctt
gcttctagagtatgtaagaactaagaaaatacttagtttttcttcttttaatttttgcag
ATGAACTTGAGATGCTTTCTGAAGCCAGAGCCCGCTTGGCTAATACTCAGGGAAAGAAGG
CCAAGAGGAAAGCAAGAGAGAAACAATTGGAAGAAGCAAG
gtatgtgtggatataggaataaaaagcaaagtgtttttctcacataacaatcaacacaga
atacttctgtgaccagatatgtggtttttttttttttttcccctctccaccagcaatcag
gcaatcaattctgcagtggatagctgggtgtcctctaattcagttaactctaatactgtc
EXON 6  219 bp
tgtatgtgtgtgtgcacctttaaattaaaactaggatttgttttggtgaatggtgtgagg
taaggatttaaataactatttcttccccaaataaatagatactttttttttaactgtatg
ggataatttatccctgtcacatggcatatgattttcaaagtgattttgcattcttttcag
ACGTCTTGCTGCCCTCCAAAAAAGAAGAGAACTTCGAGCAGCTGGCATAGAAATTCAGAA
GAAAAGAAAAAGGAAGAGAGGAGTTGATTATAATGCCGAAATCCCATTTGAAAAAAAGCC
TGCCCTTGGTTTTTATGATACTTCTGAGGAAAACTACCAAGCTCTTGACGCAGATTTCAG
GAAATTAAGACAACAGGATCTTGATGGGGAGCTAAGATC
gtaagttgcctttctgattttggaaatggaaaggaatagtaggaggagtcttacgaaggg
ccaagtattatccttgtcagagccagatttttattatttatttattttacattttttaaa
atcaattttttttttgagacagggtcttgctgtgttgcccaggctggagtacagtggcac
EXON 7  145 bp
ccacccaccttggcctcccaaagtgctgggattacaggcgtgagccattgcacctggcct
tttcagttattttcttagaaatgaggttgtttgttcaaagggtttgagtatttgtatgga
ttttaatgtttttggctatatgtaacttaaaaatctcttttctactttgatccatgacag
TGAAAAAGAAGGAAGAGATAGAAAAAAAGACAAACAGCATTTGAAAAGGAAAAAAGAATC
TGATTTACCATCAGCTATTCTTCAAACTAGTGGTGTTTCTGAATTTACTAAAAAGAGAAG
CAAACTAGTACTTCCTGCCCCTCAG
gtaatctgataaaagcaaatttttcactatgtgaatttatatgcttatatcatttattca
gcaaatgtttgaaggcctgtgtaccaggtttgtgctggatgctcttaagaaattcacagt
ttaatgggtgagacacacataaaaacaagtaattgtgggctggctgtggtggcccacacc
EXON 8  189 bp
ttggtttttttttttttttcaatagagacagttttgctgtgttgcccaggtaggtcccga
actcctgggctcaaacagtttgccctcctcggcctcccagagtgttgggattacaagtgt
gagccactgtgcccggcctcagttaaaatgttgcttactatgataattgtgtccttttag
ATTTCAGATGCAGAACTCCAGGAAGTTGTAAAAGTAGGCCAAGCGAGTGAAATTGCACGT
CAAACTGCCGAGGAATCTGGCATAACAAATTCTGCTTCCAGTACACTTTTGTCTGAGTAC
AATGTCACCAACAACAGCGTTGCTCTTAGAACACCACGAACACCAGCTTCCCAGGACAGA
ATTCTGCAG
gtaacgtgtcacgtagtagaatgaggcttttactttgtttattgtccttagaagtatcat
gcaggagaactaagcggtttggttgtgtttcttttagtgtaaatggtttgaaactgagtc
ctgaatgcatagatcttgcaatatttctgtagtagagaagctaaatagattcagcaatca
EXON 9  149 bp
tgatagaaggaatggaaacattgaaatctgccatgactggtattcattttctctgttagc
tttcattgagaaaatgagtaaggattctgcctgcttcaagattggtatagtaggaccaga
agagattctgcaagtctgtctaaacttttaaacttgcttctttgtcttcttgttaatcag
GAAGCCCAGAACCTCATGGCCCTCACCAATGTGGACACCCCATTGAAAGGTGGACTTAAT
ACCCCATTGCATGAGAGTGACTTCTCAGGTGTAACTCCACAGCGACAAGTTGTACAGACT
CCAAACACAGTTCTCTCTACTCCATTCAG
gtattgtaaatgaacacgtttttattttagaaaaacttgaattcaaggacttagcatatt
tgctttagtaatgtttacggagaatgactacttattgtgttggattttcctctttgattt
cttcttcatagtaataaataatagtgtccaggaaatggttaaatactgtggagtgcctcc
EXON 10  163 bp
agctagaccaaacattgattttaacctagagatcctaacaaaaccagctggacagaattt
tgaaatctttattcttttttttttctatatttcctgtgaaataatttatgtgaaaaacat
ttgaaagcacaatccaaatgtaagtggcacttctgttaattgggattcctgtctttctag
GACTCCTTCTAATGGAGCTGAAGGGCTGACTCCCCGGAGTGGAACAACTCCCAAACCAGT
TATTAACTCTACTCCGGGTAGAACTCCTCTTCGAGACAAGTTAAACATTAATCCCGAGGA
TGGAATGGCAGACTATAGTGATCCCTCTTACGTGAAGCAGATG
gtaaatgtcaattcccttttaatactcttaaatttttttttaatatctcatggatgccaa
attaaaatttctcctgttagtgcatatcacatataccttaagaatctatacacctgtgga
tgccagaaaaagaattatttgtaagacttgatgaaagggaatattttgggctcaaaaccc
EXON 11  165 bp
catcccctcaagcatttaacctttgtgtttgaaaccatccaattattcttagttatttta
aaatgtacagttattttgactagagtcaccctgttgtgctatcaatttttaagagactca
taaaatactggtggaatgtttaatatgcatgaattgagaaggaccacttcttttctacag
GAAAGAGAATCCCGAGAACATCTCCGTTTAGGGTTGTTGGGCCTTCCTGCCCCTAAGAAT
GATTTTGAAATTGTTCTACCAGAAAATGCCGAGAAGGAGCTGGAAGAACGTGAAATAGAT
GATACTTACATTGAAGATGCTGCTGATGTGGATGCTCGAAAGCAG
gtgggtaactgtactgaaagaagcgtgagtttggctgaatgtgtcagtaggctggaagaa
tgaagaatagccattaaatgtcccaagatctctacctagtcctttttaatattgaaaaaa
cttctaaagtaaataacttatgtcattaataatgtatcctcacataattaacatactcac
EXON 12  81 bp
gagagtgaatagactgattcatttctgttgccttagcattgcctttctacaaacttaaac
cgatttctaaactttagctattgaacacacatgatcttacataccaaagtgtttttagct
ttactgagagatatcaaatacgctatagctgcaataaaggatataaaaatcattttttag
GCCATACGAGATGCAGAGCGTGTAAAGGAAATGAAACGAATGCATAAAGCTGTCCAGAAA
GATCTGCCAAGACCATCAGAA
gtaagtgttagaatttctggtttaggaagttttaagtttctttttatatgattgctgcgt
tttacatcattcataaagactataaaacaaaatttcatctactttctggaatatagcaaa
gtagttctcaaatccaatctttaaaatgtttcagtagtaccagaaagaatttagaaggaa
EXON 13  243 bp
aagtagttctcaaatccaatctttaaaatgtttcagtagtaccagaaagaatttagaagg
aaaaaaatggaaattgcttttgaaaatgtaaaaccgctgtttaattcatgctgtaacagg
taataacattaatatattatagtgatatgtttggtaattgtatttgttttaaaattttag
GTAAATGAAACTATTCTAAGACCCTTAAATGTAGAACCGCCTTTAACAGATTTACAGAAA
AGTGAAGAACTAATCAAAAAAGAAATGATCACAATGCTTCATTATGACCTTCTACATCAC
CCTTATGAACCATCTGGAAATAAAAAAGGCAAAACTGTAGGGTTTGGTACCAATAATTCA
GAGCACATTACCTATCTGGAACATAATCCTTATGAAAAGTTCTCCAAAGAAGAGCTGAAA
AAG
gtatgattgagctggaatatttcttcttgagatttaggtagttgttaggtgctgtgtatc
atggacaaataatgaacttatttttccctgttggtattcataaacaactgaaatgtatga
ttaggagatgcatgtttagattaagtgttatgaaaaggacatgctttaaatacctccatc
EXON 14  198 bp
ttgactcaaaggcttcttaagctatttttcctaggtattgttatccacccttccaaaaaa
caaccaaccacatcttggatttgactcaaggcatgagggaaaaaattagtcttctaaagc
tctctggatatggcaagtgtttgtagtacttaaacttattgaaattattattgtaaacag
GCCCAGGATGTTTTGGTGCAGGAGATGGAAGTGGTTAAACAAGGAATGAGCCATGGAGAG
CTCTCAAGTGAAGCTTATAACCAGGTGTGGGAAGAATGCTACAGTCAAGTTTTATATCTT
CCTGGGCAGAGCCGCTACACACGGGCCAATCTGGCTAGTAAAAAGGACAGAATTGAATCA
CTTGAAAAGAGGCTCGAG
gttggtatccttttaaaattttaattttaaatgtactttgattgagataatgaactaaat
aatgccactggagacaatgtcagaaaaacacacctgaggtgcttattgcctttttagttg
ttggagaaaactacacttaagtgttggatcttcttggccttgttcattgtttttttttgt
EXON 15  213 bp
tttaggtgcaagataaatccttcttaagcttgatattttgttacagtaattgagctataa
ggagttctagtgtatttttgctttgagacacatacatgaacgcatggtacctttttagcc
ctgttatttaatagcctgcttttctcatgtatgctgatgtgatcttcccctgctctccag
ATAAACAGGGGTCACATGACGACAGAAGCCAAGAGGGCTGCAAAGATGGAAAAGAAGATG
AAAATTTTGCTTGGGGGTTACCAGTCTCGTGCTATGGGGCTCATGAAACAGTTGAATGAC
TTATGGGACCAAATTGAACAGGCTCACTTGGAGTTACGCACTTTTGAAGAACTCAAGAAA
CATGAAGATTCTGCTATTCCCCGGAGGCTAGAG
gtaacgttatatattgaactgttgtttaaaaagagtgctgcaaagaattatcagggctgt
cctcttttacttctcctatgtagactgtctctgaagttggtactgtcaggcttttaaaaa
tgagagcctaaagtgtttgactttctaatctagaattgcctctgtgtagatggatagacc
EXON 16  436 bp
aagaatggctgtgatactggttttatagcaaaagtatttgatatgtttgtttctctttga
gaaatatttaactcttaagaatcatgatttaactcagctggtttttaagataataaagta
ctgtagatttttttcagtatagttacatctaaaataattacttaattttttttctttaag
TGTCTAAAAGAAGACGTTCAGCGACAACAAGAAAGAGAAAAGGAACTTCAACATAGATAT
GCTGATTTGCTGCTGGAGAAAGAGACTTTAAAGTCAAAATTCTGAAGTACAGTTTATATT
CTGTCACAGGATTAATTAATTGCCGGTTTTCATACTCTAGAAGGCTGAAACTGATGTTTA
TCTTCATTGACAAATTTACCCACCATCTGTGGTTTTTCAGTTGTTTATTTTAAATGATAT
CGATCTTACACATTCTGTGTATAAAGACCTTAACTCCACAGGACGGACATTTTAGAGTTT
AAATTATTAAGGCTATCATTCTTTTAGTAATGTCATATTTGCAAACTTTTTTAGTTTTGG
CCTTTAATTTAAAAAGCCTAATTTTAAAGTGCTGCCTGTGAGTAACTCTTGAATAAAAAC
AAAATATAAAAAATTG
agaatgtagccttttgtttgaagtaattagatacttaagagtgcctgcaaaccagcagct
atgtactctgtgtcatatttaatgagtaactcttgggtaatcaaaatggtgatgcagtat
cttaaacacttaagaggcagttctttgtggctttgttagtttcagcaaagagtggtcatt