Gene BTN2A1 Variant 1
DNA : 11.68 KbNT_007592
mRNA : 3113 bp NM_078476
CDS : 1005 bp NP_510961
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  182 bp
gacccgataatctcaaaaggttatttgctgcttgaaatttgtgattcggtgtattctacc
cagcaactgctgagaaataaggttcgacaccattggctggttcactcacacccggccaat
cctgggctctaaaatacttagggaactcttgggactgtggaagcccaggagaccagattt
CGTTTCCTGCATCTCCAAACATGGCGACCTAGGAGAAGGGGAAGAACAATTTTTTCTCCT
CTTTTGGGAAGGTTTGTGTCTAGTAGTGCCTGTGCCCCTGGGCAGATTGGAGAGAAGAGG
GACGACTGGAGAATCGTCGAGAACCAGCGGAGAAAAGAAAAAGCAACGTTTAATTCTAGA
AG
gtaggaaacggaggggaggcgctacagctccggggtgggcacagtaggtgggggaagcgg
ggtctgctgtggacacgagacggggtcctgggacagggaaagcccaccggtggggaggcg
cggcctcgcctgtctttgcctcaggctgcccggcctgggtcgcggggaggaggaagtgaa
EXON 2  112 bp
atggcttacttcatggaatgtttaaggaatccctctctcgggacatacctgagccttcgg
atgcaggggactccctgaagttggggcactgatgagacctacttgagtgacgggagaggt
tgggcccgaccagcactgaggtgccaagactcctaggctgattctcctctgtaaccctag
GCCTCCTGTCCCTGCCTGCTCTGGGTGCTCATGGAATCAGCTGCTGCCCTGCACTTCTCC
CGGCCAGCCTCCCTCCTCCTCCTCCTCCTCAGCCTGTGTGCACTGGTCTCAG
gtagggatgtgtgccacttgctgctgtcacctatcagaaaggaacatcaaccctgtagtc
tgcaaagggaaagaaagaaggactgtggagttgttgacttaccctttcattctgaacatg
ttcattgaatttataccagcactgtccaaaaggaatacagtgaggcacaaaggccgagtg
EXON 3  348 bp
agttactgctcccaggggtgctgtcgactagccacagctactggtccccagatttctcag
cccaaagagaccctatggccatggaaaaaataagtttgtccctagaatatctgcttcctt
tcttgccttagagatgtgatggctggtgtctttgtctgactctacccctttgttgaacag
CCCAGTTTATTGTCGTGGGGCCCACTGATCCCATCTTGGCCACGGTTGGAGAAAACACTA
CGTTACGCTGCCATCTGTCACCCGAGAAAAATGCTGAGGACATGGAGGTGCGGTGGTTCC
GGTCTCAGTTCTCCCCCGCAGTGTTTGTGTATAAAGGTGGCAGAGAGAGAACAGAGGAGC
AGATGGAGGAGTACCGAGGAAGAACCACCTTTGTGAGCAAAGACATCAGCAGGGGCAGCG
TGGCCCTGGTCATACACAACATCACAGCCCAGGAAAACGGCACCTACCGCTGTTACTTCC
AAGAAGGCAGGTCCTACGATGAGGCCATCCTGCACCTCGTAGTGGCAG
gtgcgtcgcttcattttgctttgttactttggcacagtgtgactttggggaaagtttctc
tcctaacctcaggcccattgcagaccagcaaatttttgtctggactcccttttccactct
ccctgtggaaacggaattccagggaaaaatccttcctcctgcacaagggacacatgagtg
EXON 4  282 bp
ttctccaacatcaatgttctttcttccttaccctcatcctttttttcttccttcctattt
cttgtttcctatctccctcttttttacctttactttctagcttcacagaagagatgcaat
aggcacagaagagatgcaaaaggcactgacttttgcctgaaccctgatatctctccacag
GACTAGGCTCTAAGCCCCTCATTTCAATGAGGGGCCATGAAGACGGGGGCATCCGGCTGG
AGTGCATATCTAGAGGGTGGTACCCAAAGCCCCTCACAGTGTGGAGGGACCCCTACGGTG
GGGTTGCGCCTGCCCTGAAAGAGGTCTCCATGCCTGATGCAGACGGCCTCTTCATGGTCA
CCACGGCTGTGATCATCAGAGACAAGTCTGTGAGGAACATGTCCTGCTCTATCAACAACA
CCCTGCTCGGCCAGAAGAAAGAAAGTGTCATTTTTATTCCAG
gttagttctctgccctctgagactcgtcgagtgcatgggggatcctcagcacacagatgg
agcccagaacggggatgggggcagcagtgtgggtgaaatagtcctgggccctaaggacct
ggaggctgcagctgagtgaagcctttccgcttctcacaaaaggagaatcaaagtgtccca
EXON 5  222 bp
cctggaagccattgaggtgtcagccaggtgtgagccagcatcactttctccatctgagtt
ttctgagggagaaagcaggagagcaggtggctgaggagctcttcaagtgtgctcctaggg
gcactcttaccccagatgttctgtttcaaactaagtggatatttctggctgccttttcag
AATCCTTTATGCCCAGTGTGTCTCCCTGTGCAGTGGCCCTGCCTATCATTGTGGTTATTC
TGATGATACCCATTGCCGTATGCATCTATTGGATCAACAAACTCCAAAAGGAAAAAAAGA
TTCTGTCAGGGGAAAAGGAGTTTGAACGGGAAACAAGAGAAATTGCTCTAAAGGAACTGG
AGAAAGAACGTGTGCAAAAAGAGGAAGAACTTCAAGTAAAAG
gtaaaagaggctgagtatggtggctcatggcttgaatcccagcactgtgggaggctgagg
caggcagatcacttgagccctggagttcgagaccagcctgggcgataaagtgagaccctg
tttaattaaaaaaaaaaagaaaagaaaaagagtagaaggacagttcaccaccatagaaag
EXON 6  21 bp
tgtgctggtactacccagccacctgatcatacataatttctggtttctgacagtgcccta
ggcatgagggaagggagatgttgctgttcatagaaaggacggttcctgcattgtttacta
aaaacccaacttcttttagttcttctgtcaaagacatgattttctttgtttgtttttcag
AGAAACTTCAAGAAGAATTGC
gtaagtttagcctttccttaactacatgtacaatttgagttctgctcagcaacatctcat
gacattcgtctctgtctgtcccttgcaggatggagaagaacattcttacatgctggtgag
tgcctctgatgttccctcagatctcagctttctccacactagccagctaacaggactcct
EXON 7  27 bp
attgtttactaaaaacccaacttcttttagttcttctgtcaaagacatgattttctttgt
ttgtttttcagagaaacttcaagaagaattgcgtaagtttagcctttccttaactacatg
tacaatttgagttctgctcagcaacatctcatgacattcgtctctgtctgtcccttgcag
GATGGAGAAGAACATTCTTACATGCTG
gtgagtgcctctgatgttccctcagatctcagctttctccacactagccagctaacagga
ctccttagaggagatgagcaaggggcccagggcaaggtggggacagcagggaacgggggt
cagttcatcaacagtgtcccagcaatgatgcatcatgtctcttctgtcagggaatcccag
EXON 8  1919 bp
tgacctcaggtgatccacctgcctcagcctcccaaagttctgggattacaggcgtgagtc
accacgcctggccagagatcatatgtcttggatagaaaagggaacacatcttagaatgct
gagagaaagtataagaatgattgattttacttcatttgctaaactttccggatttcttag
AGCTCCAATTCTTCTCAAACTGAGAGAACTGCTTCTGTCTCTGGAGAGACAGAAGTGCAG
CTTCAGTAATTCTCAGTGTGTGAGCTGCCTAGGATCAGAGAGCCTTCATGGAAGTGGCCA
CTACGTGGGGATCCCTTCAGAGATATCTGAGACCTCTCTGGGGATCAGGAACCACACAAT
CCCCAGGGTTCCTGAGACCCCAGGCCTAAACCTGAGACTTCCTCTGCAGTTGATGTGGTC
CTGGATCCAGACACCGCTCATCCCGATCTCTTCCTGTCAGAGGACCGGAGAAGTGTGAGA
AGGTGCCCCTTCAGGCACCTAGGGGAGAGCGTGCCTGACAACCCAGAGAGATTCGACAGT
CAGCCTTGTGTCCTAGGCCGGGAGAGCTTCGCTTCAGGGAAACATTACTGGGAGGTGGAG
GTGGAAAACGTGATTGAGTGGACTGTGGGGGTCTGTAGAGACAGTGTTGAGAGGAAAGGG
GAGGTCCTGCTGATTCCTCAGAATGGCTTCTGGACCTTGGAGATGCATAAAGGGCAATAC
CGGGCCGTGTCCTCCCCTGATAGGATTCTCCCTTTGAAGGAGTCCCTTTGCCGGGTGGGC
GTCTTCCTGGACTATGAAGCTGGAGATGTCTCCTTCTACAACATGAGGGACAGATCGCAC
ATCTACACATGTCCCCGTTCAGCCTTTTCCGTGCCTGTGAGGCCCTTCTTCAGGTTGGGG
TGTGAGGACAGCCCCATCTTCATCTGCCCTGCACTCACAGGAGCCAATGGGGTCACGGTG
CCTGAAGAGGGCCTGACACTTCACAGAGTGGGGACCCACCAGAGCCTATAGAATCAATTC
CTTGGTCTCACAGCCATGTAGACAAGCCCTGGTCATCTCAGCAGCCACCGCACAACACCC
CTGGTGGAAGACACGCCCTCCTCCCCTCTGGTCACACAAGAGAACATCTTCCAGCTGCCT
CTTTCACACCCACTACAGACCTCAGCCCCAGTTTTCTCCTCCTCACTAGGCTGTGTTTTT
AGTAGTTCCTTTGCTTGTAACTATGGGATGGGATCCAGGCATAGGGAACTAGTTGTTACA
CAGCTCCCAGCCAAGAAGAAAGTGTGAGAAGTTGATGGGCAGCAAACCTGCTGTTTAACA
TCAGGGTGACCACATTAAGCCCAGTATTCCAGTTGGCACCAGAAGATATGGACTTGGAAT
GAGGCCTACAGGGTTCACCAGGATGTAAGAGGAGAGAGGAATCCACAGGACCACCAGAGA
GGAGAGGGAACCAGATATGCAGATCAGAGATAGAGGAAGTGGAACCAGAGAGCTGGGAGG
GACCAAGGTTGTAAGGGTGGCTAAGTCCCACCATAACAGCTAAGGGGACCTGGGAGATGA
TGGCTCATTTCCACCCAGCCCCAGGATTTCCAGAGCGCACATCCACAGGCCTGGACCTGG
GATGAAGATGAATGAAGAACATGGATGCACGTGGATGTAGTTTGGCTCAGGTGTCCCTGC
AGTTGGCAAGGAGTCAGTACTCAGTCCCTGAGTGTGGCTGAAATTTGAGGTCCTGGCTGA
GCCAAGGAGTAATGGACCAGATCTACCTCAGTATTCAAGTTCAGTGGGGACACCAGTGGC
TTCAAACTTCCTGGTTTCATGATATCTTGAGACGCCTTACAAATGATGGAGGATTCCAAA
GAGTTTTTGTTTATTTGGGTTAATATTTGTTGGTATTTATGGCATTTGAGATTGAAACTA
AGAAATGTTTTAATTTATTACCTTTACAACATTTATTTACATTACATACATACATTTACA
ACATTTATTAATTTATATTAAAATAGCATGAATAAGCCAATTATAGGTTAATATAAGTAG
AATGTTTGTGAAAAATAAGTATGGTATCCAAAGCAAAATAAATTTTATTGTGAAGTGTG
gcattgattaactttttccagatctaatgtgtggcttgaaagaatatgactggattctca
tatctgcctttatactcactctgttgagatatcatagactatataggctcaagaaaactt
tatcctagtgacagaatgagattaaaaacaacaaactgtgttttattattaatatgaaaa