--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (112120 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1381       1399   0    Initial     19    46    Marginal
cagaagcggctagtggcggctgcctgcgtccccaaccccctccgcgcagcgctcgcgaca
cgcgtgccaggagtgggagcgagcggcggggccagctgcgttctgagcctgggcgcagct
gccatctgctctgggaagcaccagggtgtccccgccgccctcagctcgaagtcagccacc
ATGGAGGCGCAGGCACAAG
gtgagtggtcgccgatcgccccgagagtcaggtcctggggcgcgcataaaggctcttttc
ctgcaccacctaacttcgctctcggacagaacagattggtgccgtgttgcacatccagaa
ctccactcccacccgcgcctttggtataatgcctgctgcccaaactcaggatttgctgtg

Exon  2 +       1798       1961   2   Internal    164    49    Marginal
ggagaggcccctcctcaggaaatgcgcccgtggaatgctctaccctcttccgcagccagt
cgcccctggccttcccaacctcgcggctgcccgaaggacctgttgtgccgggtccggaaa
gcgtgtttcgctccctttcccttgagggagtggggagggaatgtgactcttttcgcccag
CGCCGTGGACTCGCGGCTTGTGGCTCCCAAGTTAGGGAGTGAGAGGATCGCCCGCCGAGG
GGGTGGCTCCGCAGCCCGGCTGCGCGAGACGCTTCCCGCTCGGGGACCCGCCTTCCGAGG
CCAGGTGAACGTTACCGGCCCCCTGACCTCCAGCAGATCCACAC
gtgagtcccggtttccgcgatcggggagcgacctctgcctcccgtggcgcgcggggcccc
cggccgcccagctccctgctcccggggctgcctgctggaggagcctgcggtggcttcagg
aagggcggcctcatatcttggggtcacacttggaacagggttggggaattccgatggaat

Exon  3 +       2584       2676   0   Internal     93    50    Marginal
ctaggggcagaacgccctgaatgagagtgggttggcgattgcgtgggcctggagtcgccc
aacaggtttgctgccaggattacaattgtctgaacagcacgaaccttactcgtttgttcc
atcctcctaagtcctgcccgtaaagctgccgcttcccatattttttcctctattatgtag
ATAGGAAATGATAATTCAACCAAGGGTGAGGGCAGTTGGTCAAATTCAAAAGCAGAGGTC
AGGTTGGAGGCCTTCACGCCAGAACTGAAGCTG
gtgggagcagcaccggagctttccaacctgacttgcatattagaattatttagagagtct
tcattactggccttggccaaccccatcccagtcaaactggaatctttggaacctgaacat
gggtatatttgaaagcttatattagtgaggatggagaagaactatagcagataggaaaca

Exon  4 +       8026       8133   1   Internal    108    57    Marginal
tgggatcatcatagctcactgacaccttgaactcctgggctcaagcaatcctcctgcctt
ggcctcacaaagtgttgggattacagtcatgagccactgcatctggttacagttagaata
attcataagggccttagaactttttgaatagtaagtgagcatgtaacttaaagtcaccag
CTACATTAGCCCCTAACAAGAGAGTCAGCCTGTACTTTGAAGTTTTGAAGCCAAGCATCG
ACTCCTCCTCTCTAGCTATAAAAGTCCTAGCTGACATCTTCTTCCAGT
gtaaggctgtttcatctatatgaaaatgtgttgtttagtttagccactttcatcaactat
cttagccagatcttctggagagcttgctgcagctttggcaacagcccttgctgcttcacc
ttgcacttttatgttacagagatgactttttttttttttttttttgagatggagtcttgc

Exon  5 +      10363      10418   1   Terminal     56    87        Good
ttaacatgttaatacaagcaaagtgcttaaagcagggcctagcacatggtaagtagtata
taaatgtttgctgttgcttttattagcatatgctgaaaactttgcatccattattttatc
aaaaccttataataacatcatgaggtagatacctttacttttaactcattttataaacag
GGAACTACGAGTCAGAAAAATTAAATGAAGAAGACAGGATTCAACTCCAAGTTTAA
ttgagtccagagaatgagcttaactactatactgcactgtgccttaatgtgtgctgtgcc
acacgtgcaaaggggaagctaagatgaacttgacatggtgtcatcttttcaggaggatag
gcaaaaaagagttgagagtcgttcctgtgggttaacacctagaactaatgagaggacata

Exon  6 +      15612      15728   0     Single    117    41    Marginal
ttggtgacttctttcattaagtgatggggaaatagatcagttctatcaagcactgccagt
ttatcacttactatctcaaatctttcagttagacacaaatagaactttgtatgacctttg
ctaatggagagcaacagtagaaaattattcatcccacgttttgggtacttactattaaat
ATGCTTGTTTGCAATGACCTAGGAATTCACAACATATGCAAGTACAAAACCTACCTTATT
GTGACATCTGGCCTCAGGAAGAGAAAGAACTTGGTGCCAGTGTTCTTTGACTCTTGA
cccatcataacgggctcagtaacctctcccctcagatgattccctgagacccaccacagg
gatatcttctcttcttagtaccctcttctctgagtaccctcacccctcaaatgatatcct
gagactcacctcaagggggatcctctcttctcagtcccctctcctctcaaatggtgtcct

Exon  7 +      28368      28456   1   Terminal     89    49    Marginal
atgcattcaggtatgaaaaatgttttctatttacttgttcagaattattttaaataaagg
aagaaaatcacagcagcttcctgcttcggaggcccacagagttgcagccaaatgacttgc
tattatcataggtctttatgtttgctgaatgcttttcagtatatctgattgtattcacag
CCCTTTCTGGTGGCATGAAGGAGGCTGGTGTTGCTCTTGTGCAGATTACAAAGCTAGAAC
CAGAGGAAGGGGAAGAAATGATGGCTTAA
ggcattcttagaagttgggttcgagcctacagtttgtttttctctttaagatctggaaag
gtgaagaatctgatggcagtgaacccagtaatgaatacgatgttaatattataatgttat
ttattttatttacttatatactatagtaattaatttgtagtaattaagtagtaaacctga

Exon  8 +      28660      28699   2   Terminal     40    94   Excellent
agcctacagtttgtttttctctttaagatctggaaaggtgaagaatctgatggcagtgaa
cccagtaatgaatacgatgttaatattataatgttatttattttatttacttatatacta
tagtaattaatttgtagtaattaagtagtaaacctgataatatctgatctaaatgattag
CATAAAGAACTATGTCAAGATCAAAATTCAGGATGACTAA
gaggtcagaacataagatactcacgcagaaggatgtaggaataaccaagagaactgaatg
acctctctaagagcaccaagaaacatttacgccaggatacacaaagaactaagacatttg
aggggtttggcgatggtgtcaagaggtgctcgctgttttacattattatgtatatgctgt

Exon  9 +      34300      34389   0   Terminal     90    70        Good
aacggtgtgacgttgacaccatagctaagcactatgtgacaccacatagttaggggcaga
aaactgggacctcagccacagaaaagtcaaaatgtgacttttattgtatgccttataaag
ttaattttatatagattaaaatcttaaccaaaaactataacacaatgtaaatattcacag
AAAAATGAGATGATCAAGTACAACGTAGTAATTGGGGTGACTGTTTCAGCCAAGGGATTG
GAAATGCAAAGGTACAAAAGAAAAAAATAG
gcattttatcctttatgaaaatgttaaatatttgcaagaaaaaatatatcatcaaattta
atagacaaacaataggtgggagaaaggattgcattgcatataccagttaatagattaata
tcaatacaatatgaaaaaaatctaataatttgatagagcaatagaaaaataggcagataa

Exon 10 +      46480      46575   0   Internal     96    75        Good
tgcagtgaacacacagttccctacaatcacaacaatgagttcccctacctgaaattccat
agtgctgaggctgagaaatccggcgaaatggtcatagcaagatgagatgagtttagctga
tttccttcatccttaggaataagaacatgttaacatattaacattattgacctctaccag
CACTTAAAGGACAAAAAGCCTATCAAATCTAAACCTTGCTATGAAACAAAATCTGATTCT
TGTGAGAGAAAAGTCTTCCTTGATTCTCAAGAGAAA
gtaaaaggtttttgtggttttgacttaaataattctaatgactcgatttgtttattggac
aatagattgaaggagctaagctggattttgttgattttaatttttaccagtaatgtagta
taaaaaatgttttgctagacttgtatgatttactaaataattattgatatttgcatatca

Exon 11 +      64187      64293   1   Terminal    107    60    Marginal
tattaatacacctatgctcagaagaaataccagaaaggaaggatcaaaataccaattttt
gggtaatatgattaatgttgattttaattaatagtggataattttactgtcttctaggat
gatcagatattacttatgaaaaaggaaattacttagcattgaaactggcttctggcatag
AGAGAAGGGATGAGGATCTGATGAACGTGGATCAGCAATATGCCACGTTTACTAATGTTT
GTTACCGTGTTGGCAGTGACATCAGGGTGCCAATGGCACACTATTGA
ttcagacataaggatgtgaataccagggactcaagagaagggacagcttcagaactatac
acacttgagccatatttttattctctttatctaaaatgttctgattttgtaggataatta
tttgcctttttctttttactttagacaaaatccattttcatttgtttattaaataattat

Exon 12 +      69737      69924   1   Terminal    188    54    Marginal
atgtgtggacacaggaactcaagttccctgatagcacgtatgcattcggattttaccttc
aatgctaggattcaattttaacaaggacacatagaaagccatctctgcagtctcactgct
ggccttatgaagaactgaggcctcctatagagtcagcccctctgccccaattctccacag
AGATTCTTTATGGGCCCCTGGTCACAGACAACTCCTCTTTCTGTCTGAGGAGAGATCCTA
CTGGGTCTGTTAGCTCCTTGGGTACCAAAGATACCTCAGAGACCAGCCTATTAGATGACG
GCCTTGGAGTCAGGCACTCAGTTGTGGTCATGATCCAAAGCAAGACCTGTGTGTACAAGG
ACTTCTGA
cccctgactgctttgctgaaaagaggtcttgagtgtgccaggtgtccagcctcctctttg
tttccttcctctccctactttcctcgtctcttctgtgaaataaataattcaaaataaaag
ctgttgggactttaaattattttgagccttgaaggaatgtgaatatgggacctgagtcac

Exon 13 +      76547      76695   0   Internal    149    87        Good
aattctgtttctactttgagatattagactatcatctgtatggggtgtatttggcaaacc
tacacatgggattgtataaataggagggtcagaggctgctttggaatacccagagcttct
gtaagtatccttttttgctggtctgacattttcccccaccatttcccctccgccttgtag
CTAGAAGACGAAATTACAACACTACGACAAGTTTTGTCAGCGAAAGAAAGGCATCTAGTT
GAGATAAAACAAAAACTCGGCATGAACCTGATGAATGAATTAAAACAGAACTTCAGCAAA
AGCTGGCATGACATGCAGACTACCACTGC
gtaagtatcatatgaacagtgttttattaactcagcctgatgtctcctcactctgttgtg
ttttgtttcatttttcctacaaggctgatttggtgcatgaagctaggaaaaaaaaatact
ttctctaaaagcaaagcaaagaaatgtgaataatcattaagtatgctgcatgtgaagcag

Exon 14 +      79108      79182   0   Terminal     75    52    Marginal
tatagccaggtagtctacttaatgtaaagcattttgctggatgaatagcctagatttatt
ccctggggttatggagtttagagtctagttaggaagacagagtttgagtttttgttgttg
ttgttgttgttgttgtttgtttgtttgtttatacgacaaaatcatggacaagggggatag
AAAGGATTTGGAGAACAGATCAACAGTGGTTTGCAGGTGGATGATGAAGGAAATAGGACC
AAGTGTGATGTCTAG
gcctttgacttgggctactgagtgagtgttggaactgtttacgagcattgtggttaggct
catggttgcttgggttgaaatctaggccttgctgcattcatgaagtgagatcatcttaat
gccgatcccataggtagtgaagattcagtaagttaatgttcgtaaaggctgcaggacagc

Exon 15 +      94958      95102   2   Terminal    145    68    Marginal
cccactttcataaccaactcagaaatttctcatccctataggtagcatcactgtccttcc
tgtcatgatgctcacagcctcaggacaacctttggtcttgctcttatttatcacttacca
tctcctgttgaatctgtccattctatccctgtaatccatcatacctctttcttttcctag
TGCCACTACTCCCAGTTCAGAGTCACAAAAGGTTGTCCCTTTTGATATCACCCACTCGTT
CATCTACTATTTATTGAGTTTCTTCTTTATCCCTTTGTCAGAGACCAGGGACACAAAGAT
GAATGGCTTCCTTGCCCTCAAGTAG
tcaagtctagtatgacataggcttatcaacaaatattcacagtatatattcctaaaactg
ttttgaaaaaaagtcactatattatcttcagataatgtgcttttattattcccagctata
aatactagaaaagtaagctaaataactagctgtgttttgcctttttctggcttattttac

Exon 16 +      95711      95812   2   Internal    102    85        Good
cttctgatgaacagcagccaacccatcatccccagacaatgaatggaaacagtggttttg
tggatcttcttcctaaatctgttgaggaaaggacattttcaaagtaaggagtgagaagga
agatgaattgtttatgggagatcatgatataaaaaccatgttgttctgttttatttctag
CTACAAGAAAACACATGAAACCCTGAGTCACGCAGGGCAAAAGGCAACTGCAGCTTTCAG
CAACGTTGGAACGGCCATCAGCAAGAAGTTCGGAGACATGAG
gtactgtgggaaaataccatgggaacggcgctaagcccttggctttccgattgaagggag
cactagctattagctgctcatctcaacatatgtatttttttattttaatggataaaaatg
ttatatggctgatatgattgatgactaagataaattttcacactgggacattttctgcct

Exon 17 +     102927     103040   0     Single    114    50    Marginal
ggcagtcatgtgtgcaggcttggccaaataaaacctgcaatggaaatgaagtgccaataa
ctatatactttttgagtcatgcaagtataattttactaacatttcatcatgaaacagcat
tacggaggatcactcataggaatttgactcgtgtttgagtcgtacacaaaatgtgatgcc
ATGTCAGGGCCCTCTGAATTCACCATTGTTAATCTGTACAGCCTGAATGCAGGTACATTT
CTGACCATGTGGAGCACCAAGGACTCAGGAGACAATCCCCAAATTCACTCATAA
acatctatgttcattgccttttagtagtataaaagtgatacttcattctgcaccacataa
tgaaacctatattctatagctgttctcctttataaagtttttctaggccattcctcttat
tttacttttttttttttgcactcaagagagaataacaagtgccttattaattcaacattt

Exon 18 +     104527     104598   2   Internal     72    52    Marginal
tttctgaacctaacctaacagaagtgacatacattttaaaacgtggttggtgcaggtggc
aagctgacaggtagctctgtggcagaggccgtgtttacagatatgagcagaaaaccaaac
agcatggttgctaagacagctaggcctttggagctgacctctctctttttgttattttag
GAATTCTCCTACTTTCAAATCATTTGAGGAGAGGGTTGAGACAACTGTCACAAGCCTCAA
GGTACAGATGAA
gtgaattctgtgtgagtgggtccattgactcaggacagcttagccattgctgcggttagt
ttaaagtcgaggcagggccaagaaggcaggcttgcatcaagtcagaccttttctttcaca
tataaatctatgaataaaaccactattgaatagtgttactatatccttagagttgtttgt

Exon 19 +     110263     110391   0   Terminal    129    45    Marginal
caagtatgaataatattctagcactctactaaaggaaacaaacttctgtgcattcttttg
tctctaaagatagaaagtatttctgaatttgaaagtaatccagcttttggtattcttata
aaaacattacaaaaatgatagtaacaactaactgcatttttgtggatctgctcatttcag
ACGAAAGTAGGCGGTACGAACCCTAATGGAGGCAGTTTTGAGGAGGTCCTCAGCTCCACG
GCCCATGCCAGTGCCCAGAGCTTGGCAGGAGGCTCCCGGCGGACCAAGGAGGAGGAGCTG
CAGTGCTAA
gtccagccagcgtgcagctgcatccagaaaccggccactacccagcccatctctgcctgt
gcttatccagataagaagaccaaaatcccgctgggaaaaacccaggccttgacattgtta
ttcaaatggcccctccagaaagtttaatgatttccatttgtatttgtgttgatgatggac

--------------------------------------------------------------------------------