--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (5655 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1438   0    Initial    238    79        Good
gctgcttgcactctgaatttgggctattcaggtagtgtgctcaaagttgaaaccgcatac
agcacaactcaagtttgcatcagactgggaagcgaacttaagccagcggtgcgtggccca
ggagtgggaaaggaaatggatgcctgaagtggaagaggtggtgcagagggggcaccgccc
ATGCTGCCCTGCTTCCAACTGCTGCGCATAGGGGGCGGCAGGGGCGGTGATCTCTACACC
TTCCACCCCCCCGCCGGGGCTGGCTGCACCTATCGCTTGGGCCACAGGGCCGACCTGTGT
GATGTGGCCCTGCGGCCCCAGCAGGAGCCTGGCCTCATCTCTGGGATCCACGCCGAACTG
CATGCCGAGCCCCGGGGTGATGACTGGAGGGTCAGCCTGGAAGACCACAGCAGCCAAG
gtgagcattaagcagggcagctttgcccctgggtggttgaagcgccaggctggaatgagt
aaggtctccacaagaccctgctgcctgcctcccatactcccatcagattggatggatagt
cgtggtccagaccttcatcttcccaccagaagtgtgcacagtcagaagctctctgccaga

Exon  2 +       1545       1598   0   Internal     54    50    Marginal
gatccacgccgaactgcatgccgagccccggggtgatgactggagggtcagcctggaaga
ccacagcagccaaggtgagcattaagcagggcagctttgcccctgggtggttgaagcgcc
aggctggaatgagtaaggtctccacaagaccctgctgcctgcctcccatactcccatcag
ATTGGATGGATAGTCGTGGTCCAGACCTTCATCTTCCCACCAGAAGTGTGCACA
gtcagaagctctctgccagactgaccctttttggtcccgtttagctcatacaggacctgg
gatatcatcagaaagatatcacagtggggatgttctgaggccactagaggccaagtttag
acttgattcagtttccagctttgctgaggcactctgttcctgggttagggcagttctatg

Exon  3 +       3236       3616   1   Internal    381    63    Marginal
ccagaaatcatacagatttctccactcctgactctggtcatttctgtttttgtcctccat
atttgcctggtgccccaccatcaacaggtactttggtcaataatgtccgactcccaagag
gtcacaggctggaattgagtgatggagacctcctgacctttggccctgaagggcccccag
GAACCAGCCCCTCGGAGTTCTACTTCATGTTCCAACAAGTACGAGTCAAGCCTCAGGACT
TTGCTGCCATTACCATCCCACGGTCTAGGGGAGAAGCCCGGGTTGGGGCTGGTTTCCGGC
CTATGCTGCCCTCCCAGGGGGCTCCACAGCGGCCTCTCAGCACCTTCTCCCCTGCCCCCA
AGGCCACACTGATCCTAAACTCCATAGGCAGCCTCAGCAAGCTCCGGCCCCAGCCCCTCA
CCTTCTCCCCTAGTTGGGGTGGACCAAAGAGCCTGCCTGTTCCCGCCCCACCTGGGGAAG
TGGGGACCACGCCTTCTGCTCCACCCCAACGCAATCGGAGGAAATCTGTTCACCGAGTGT
TGGCGGAACTGGATGATGAGA
gtgagcctcctgagaacccgccaccggtccttatggagcccaggaagaaactccgtgtag
acaaagccccactgactcccactgggtaagtggagtcctcacttggccctctcagtgttt
tactgcttttcgattccttgtatccctaggctgtgaggaggtccccctgcctggggggat

Exon  4 +       4173       4202   1   Internal     30    90   Excellent
ctcacactagaggtttttaggcccaccctatgtgtttttaaggacagagtccaggctcac
cttagttctcagaccactgtgcctctgtggcctcaccctatgaccagccatagggtggca
aggtctaggccttctcctacaggtttccggtgacccttgtgtctgtgtcacttccttcag
AAATCGACGTGGCGTCCTCGGAAGTACCCA
gtgagcgctcccatggctccccctgcagttgggggcggggagccctgtgcagctccttgt
tgctgcctgccccaggaagagacagtggcctgggttcagtgtgatggctgtgacgtctgg
ttccatgtggcctgtgttggctgcagcatccaggctgccagggaggccgacttccgatgc

Exon  5 +       4278       4387   0   Internal    110    62    Marginal
agccatagggtggcaaggtctaggccttctcctacaggtttccggtgacccttgtgtctg
tgtcacttccttcagaaatcgacgtggcgtcctcggaagtacccagtgagcgctcccatg
gctccccctgcagttgggggcggggagccctgtgcagctccttgttgctgcctgccccag
GAAGAGACAGTGGCCTGGGTTCAGTGTGATGGCTGTGACGTCTGGTTCCATGTGGCCTGT
GTTGGCTGCAGCATCCAGGCTGCCAGGGAGGCCGACTTCCGATGCCCAGG
gtgccgggctggcattcagacctaaggtccaccgccaaggcaccatcggacacacctgcc
catgagtagacacagcagcgagcaaataggtctgataaataccccccttcccttccctcc
ccaagagggaatgactacagggaagaaggatggattgatgtggactcattcagggcctgg

--------------------------------------------------------------------------------