--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (29896 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1234       1492   0    Initial    259    65    Marginal
aatctgttttttgcccgcggtggggaagggggcagatctcgggaggccccgagagccttt
tagtttttggtgggggaagagcgagagcgcgcgtgtgcccgcgtgagtgtatatgagaga
ggggcgggcgggcgcggggcgggggggatggccgagaagcgaaggggctcgccgtgcagc
ATGCTAAGCCTCAAGGCGCACGCTTTCTCGGTGGAGGCGCTGATCGGCGCCGAGAAGCAG
CAACAGCTTCAGAAGAAGCGGCGAAAACTGGGCGCCGAAGAGGCGGCGGGGGCCGTGGAC
GACGGAGGCTGCAGCCGCGGCGGCGGCGCGGGCGAAAAGGGTTCTTCTGAGGGAGACGAA
GGCGCTGCGCTCCCGCCGCCGGCTGGGGCGACGTCTGGGCCGGCTCGGAGTGGCGCAGAC
CTGGAGCGCGGAGCCGCGG
gtgagtgggccccttcctgcctataacttctctccggcgcgaacctgaacttctgcgagt
ctgtgggtgtgcgtgcgcgccgcgtccctacatggccaaggccactcagccactagcgca
ttggccgtgtcagtcgcaaagctcgccgcgcaacctggtcaccctccagacggttcagat

Exon  2 +       2753       2838   0   Internal     86    95   Excellent
cgcggctggcttcccctctgtttccctcaccagttccctttctctgtcctttgctgtcca
ggcggctgtgaggacggcttccagcagggagcttcccctctggcgtcaccgggaggctcc
cccaaggggtctccggcgcgctccctggcccggcccgggacccctctgccctcgccgcag
GCCCCGCGGGTGGATCTGCAGGGAGCCGAGCTCTGGAAGCGCTTTCATGAGATAGGCACT
GAGATGATCATCACCAAGGCCGGCAG
gtaatgggcaagctggcgtggacgcccctccctaccccagaccctgtcttcactcacctc
tagctcaatcaggaagaagggcctgcagctcggtgggggttctggatagcattttcggtc
aaacgggaccaggccccagaccgtggttcactttggaggctagctttggctacccaccac

Exon  3 +       5026       5127   2   Internal    102    88        Good
aaaaatctcagttctgatatgttctatgtcctgactccttgaattacattggcaaagtga
atactataaatttatccatattaaaaatagagatccaagaggtttctttgcttattcacg
ctccatccttagtcacaaacaaaaaccccaaaccctctttctcttcgcctttttaaatag
GCGCATGTTTCCAGCAATGAGAGTGAAGATCTCTGGATTAGATCCTCACCAGCAATATTA
CATTGCCATGGATATTGTACCAGTGGACAACAAAAGATACAG
gtacagtgattagatactgaacaattaaaaaaaaaaacactaggattttgcaggctagtg
cctgtttgatctgtgaggactgtgatctttgcttccagaagtctgtagaatttccagatc
catactttaacgcccatgggtgccagcggcccagatggtgccttttcttgcggcaaatgt

Exon  4 +       8528       8684   2   Internal    157    95   Excellent
ctcagagtggtttggaaaagcgcttgaaattttatttttagtgtaaagaggaaattgatt
tattttaaaactgaaacaaaataggcacacattttgtctgattctactgagttggacatg
ccaagataaaaacagtatactgaacgcctggtcattgccttctaggtatgtttaccacag
TTCGAAATGGATGGTGGCAGGTAATGCTGACTCGCCTGTGCCACCCCGTGTGTACATTCA
TCCAGACTCGCCTGCCTCGGGGGAGACTTGGATGAGACAAGTTATCAGCTTCGACAAGCT
GAAGCTCACCAACAATGAACTGGATGACCAAGGCCAT
gtgagtagatggcctctctaatgcatctgtagatggcacagccacatctacactgtgcct
gactaaaggaaatgaatgcttctaagatcataatgttcattgcctgattgattagtatgt
acactgtctttgcagaatcaagtttatatttgcatagactgtgcctgttgccagaattat

Exon  5 +      21057      21121   0   Internal     65   100   Excellent
atgatttctgaaattttccttagctttactgctaggatattaaaatacttggggaataaa
agaggcttatacaatagagtcctctaacagttaacttttgactcattgtagttttgcaac
caagtaaaaacttgcttgacatttatataagatttgatatttttttttcctactctgcag
ATTACTCGCCTGAAGATAGATAGGAATCCATTTGCTAAAGGCTTCCGAGACTCCGGGCGC
AACAG
gtgggccttagtgaagaccattccggttatgataaatatatttgatattttattatgaat
tttctattacaaagtaaatggctaaatttactaatacgatattgaaatcatttctgatga
ggactgttgtgcctcggagataacttatttttgtagtgtaatggtgtcacctaccctaag

Exon  6 +      22866      23154   0    Initial    289    47    Marginal
gaatatacaactagcaactatatccaagctatcaattactctagcaaagtcttcactgct
actgactcaggggtcacatgcttgtatatagtccatttttgaagggataaatttaaaata
tttgaaaaatactttgtattttgaacagataatagtgaagaaacctctacaagaagtgag
ATGACAGATACATATGACAAGTTTTCAGGAAGAATTCTAGATACTCAGCATAATGAAAAT
ACATTTGGATACTTAAATTTGGTCAGTGAAAATGACAGTGGTGTTGTTGAATATAAAATA
CTAGGACTATATTGTTTGATATGGCGAGTTCAAAATGCTAGCTTTGATATGGATTTTTCT
ATCCCTTTGGCTATTTCAGGAGTATGTAAGCCTGACATCCATGGTGCTTGTTACTATTTC
TTCCCTGACTCTAAAACTTTAAAAATTTTGGAGGAACATACAGAAGACA
gtgaattatgttttaatgcttttaagattttgttaaaatttaaaatttttattttgttcc
aagtgtttaaacaatattatagtacatgaaaagcacattgagcctatatatggctttctt
gctagtgaaatacagtttcaacttttttccttgctgaaactctcttgcttattatagaca

Exon  7 +      26791      26885   2   Internal     95    94   Excellent
taacaggatgttagcccattgctgaagcatttcttcttgccagtggcaagatcctaactg
gacagtgtgggggtactgtcaatatcagtgttgttttgagatgcttgctgctggtgaaag
atccaaatgctcctaactagacttcttttgtccacccctatcctgaccctttccatttag
AATGGGTTTGGAAGCCTTGGTGGAATCATATGCATTCTGGCGACCATCACTACGGACTCT
GACCTTTGAAGATATCCCTGGAATTCCCAAGCAAG
gtaactcacaaagtctcctgggtcatatatacagcccgttcctgcctagaaactcaggca
ctaaaagtgtacaagtcattatttatacttacaataatgacctcatcaccagcattgtcc
tacagattccatctgtcttctgcatggtatggggatggatcaggaaaaaacggctctcat

Exon  8 +      27973      28611   1   Internal    639    56    Marginal
taattggaaatgagatttttcaaccagataattccttgaaagctgagaccatctcctttt
catctctgtagcattcctccaacccttgccttgtaacaagctgtgtctagctcatattta
caaaattgaaaggaaaggatgactgtggagtcattctttacatttcaacttcttttgtag
GCAATGCAAGTTCCTCCACCTTGCTCCAAGGTACTGGGAATGGCGTTCCTGCCACTCACC
CTCACCTTTTGTCTGGCTCCTCTTGCTCCTCTCCTGCCTTCCATCTGGGGCCCAACACCA
GCCAGCTGTGTAGTCTGGCCCCTGCTGACTATTCTGCCTGTGCCCGCTCAGGCCTCACCC
TCAACCGATACAGCACATCTTTGGCAGAGACCTACAACAGGCTCACCAACCAGGCTGGTG
AGACCTTTGCCCCGCCCAGGACTCCCTCCTATGTGGGCGTGAGCAGCAGCACCTCCGTGA
ACATGTCCATGGGTGGCACTGATGGGGACACCTTCAGCTGCCCACAGACCAGCTTATCCA
TGCAGATTTCGGGAATGTCCCCCCAGCTCCAGTATATCATGCCATCACCCTCCAGCAATG
CCTTCGCCACTAACCAGACCCATCAGGGTTCCTATAATACTTTTAGATTACACAGCCCCT
GTGCACTATATGGATATAACTTCTCCACATCCCCCAAACTGGCTGCCAGTCCTGAGAAAA
TTGTTTCTTCCCAAGGAAGTTTCTTGGGGTCCTCACCGAGTGGGACCATGACGGATCGGC
AGATGTTGCCCCCTGTGGAAGGAGTGCACCTGCTTAGCA
gtgggggtcagcagagtttctttgactctaggaccctaggaagcttaactctgtcatcat
ctcaagtatctgcacatatggtctgatgaagcctttaagttaaatgacatttggatctgt
ctaacatattttctttttcttttttaaaagctatgtggaaagaaactctctgtggtttat

--------------------------------------------------------------------------------