--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (44569 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        927        962   0   Terminal     36    70        Good
tctggacaacatcaaaacaagcagccccagcatgcatcccgacggctcttgttgttggtt
ggagaatgagcccagcagtcaggcttgcaacccacttcgaatctggaccagggttctgac
acggatcctggttcacatcacgctgggccttgtggccaaacacgtgtgttttctccatag
GGCCTTGAAGAAAAGCTGGCGGTGCGCATGAGATAG
gagtatattaagttcctggctgctcggggcactacgggaagattactgggctgtgatatg
ggccagcactcagattccctgcggtgggacacagagggcgggttgtttgtgctgctggcg
tggagcaccgacaagcctgtggagaaccagttataataaacacgacaggcatcctgggag

Exon  2 +       1371       1792   0    Initial    422    91   Excellent
aggggtgcacctttgaagtcagctggaccaaggaaaggccctgccctgaaggctggtcac
ttgcagaggtaaactcccctctttgacttctggccagggtttgtgctgagctggctgcag
ccgctctcagcctcgctccgggcacgtcgggcagcctcgggccctcctgcctgcaggatc
ATGCCCACCACCGTGGACGATGTCCTGGAGCATGGAGGGGAGTTTCACTTTTTCCAGAAG
CAAATGTTTTTCCTCTTGGCTCTGCTCTCGGCTACCTTCGCGCCCATCTACGTGGGCATC
GTCTTCCTGGGCTTCACCCCTGACCACCGCTGCCGGAGCCCCGGAGTGGCCGAGCTGAGT
CTGCGCTGCGGCTGGAGTCCTGCAGAGGAACTGAACTACACGGTGCCGGGCCCAGGACCT
GCGGGCGAAGCCTCCCCAAGACAGTGTAGGCGCTACGAGGTGGACTGGAACCAGAGCACC
TTCGACTGCGTGGACCCCCTGGCCAGCCTGGACACCAACAGGAGCCGCCTGCCACTGGGC
CCCTGCCGGGACGGCTGGGTGTACGAGACGCCTGGCTCGTCCATCGTCACCGAGGTAAGA
GA
gtgagctcagggctcagatggagaagcaaatggtggagattttctcaaggaagcaagcag
ggaaggcccggctcttataaaccctgcctggacatctctttggcctgcatgtatcttaca
aaatcctagtttccaaatgagaacatgcagcttctaatttgtctggagaataactggatt

Exon  3 +       4724       4897   0   Terminal    174    57    Marginal
tatataattatgaatttacatgtaaaatataaatatataactgaaatacatggtaaagtc
aatgcattttatgcttgttgccctcccatgccatccccaactacatctatgatataatcc
aaacctgtgagtataatgttaaatgcaagtagaacattttctctgattatattattttag
GCTGAATTAAAACTTGCAAATGTGTTAAGGATGAATAATGATGGCTTAATATATCACACC
CCCAAGGCATATGCACTTCACAGGGGCCTGGGGCCCAACTGGCAGCAGAAGGGAAGAGGG
ATAAAAGTGGAGGCACAGGCCACGTGCACCTCATCCATCACCCATGGTTATTAA
ttgtctcctcagctgccctgacaaggctcttcctggggctttctgcgggaggcttgcaag
gtgaaagggaaggtttttatttttattgctgcagaattgaggatgattctttaaagatga
cgcattaaatcaggagagacacattaacaaggggaggtccggagtccaccttgcacccct

Exon  4 +       9426       9604   2   Internal    179    69    Marginal
gtgctacctggacctggagtcacagattccctttgtggctatcagtctgtgcctcctgga
ttcataaaatttaaagttaacctctaactttgtttagatttccataacttccatgcattt
tccacaatcttcacaaatcaaaattaattcaattccctctctttgtttttcttcctgcag
GTTTGGCCGTAAGCTCTGCCTCCTAACTACAGTCCTCATAAATGCTGCAGCTGGAGTTCT
CATGGCCATTTCCCCAACCTATACGTGGATGTTAATTTTTCGCTTAATCCAAGGACTGGT
CAGCAAAGCAGGCTGGTTAATAGGCTACATCCTGAGTAAGAATGTTTGTGCTTGCAACT
gtgagaacaaagcaacctcgctgccaaaatagagtcaggtggggggcggcatgcaagaaa
agggacccagcttcaagacaatattgagagatttttttatttctgtatcaaaagaattcc
taaaagcatatcaactcattcagcattcctccttataaactaaaaaaatgaaggcagaaa

Exon  5 +      10744      10912   1   Internal    169    88        Good
aaaacagcaatagttataacaaaataaaaaccaaaaaacacttaaaaatattcagagagt
tgcgtagaatattctagaatttgtctatatttttgaggttggtgttctagtttcctgata
gctggacagccaactcattattgtattgaattgcattaaccattcaaattctctctgcag
TTACAGAATTTGTTGGGCGGAGATATCGGAGAACAGTGGGGATTTTTTACCAAGTTGCCT
ATACAGTTGGGCTCCTGGTGCTAGCTGGGGTGGCTTACGCACTTCCTCACTGGAGGTGGT
TGCAGTTCACAGTTTCTCTGCCCAACTTCTTCTTCTTGCTCTATTACTG
gtaagtccatttggaataaaaaggaaataaatcaaagtattttattctgctaagaagtct
gccttccttaatgcacactatctttctgattctgagattgctttcactctccagacccat
ttcacaaagagcccaattccatgtttcaggaataaaaaccacaagcttcacctctccgtc

Exon  6 +      12830      12944   2   Internal    115   100   Excellent
tccctgaggagggatttagcatttgagggaggaaagaaccacatatccccctacacgagt
gttattttctttggagatccaactgtattaacatcctcagagaaatctgattataaaaaa
atgggggatggggtaaggaggattcagtaagagttgccctccgctcaccttgtaccctag
GTGCATACCTGAGTCTCCCAGGTGGCTGATCTCCCAGAATAAGAATGCTGAAGCCATGAG
AATCATTAAGCACATCGCAAAGAAAAATGGAAAATCTCTACCCGCCTCCCTTCAG
gtgagccagggccttaagtatcaaatcaggggatggagaaaagggaggctctggtaagat
tcatgcatgccagtgatctcagcagggaaccatggaagcacccacccccttgcattttgg
cttacctgtagcggaatgcaacagagaattttatatgctaagatttgtggttccgtggga

Exon  7 +      13140      13282   0   Internal    143    68    Marginal
aagtatcaaatcaggggatggagaaaagggaggctctggtaagattcatgcatgccagtg
atctcagcagggaaccatggaagcacccacccccttgcattttggcttacctgtagcgga
atgcaacagagaattttatatgctaagatttgtggttccgtgggagaatatttcaaacag
GTGGAAACCATCAAACTAAAAGAGAACCAGAAATCATTTAAAGGTCACGTGAGGAGCTTC
TGTCTTGTGCAACTTAAGCCTTCACCAGTCTCCTATGCCCAGGTGCCCAGCACCCCCATC
ATCTGCATATTCACCATCCTCAG
gtcagattcttagatcagtaaagcagttctttaaacacacatgatttcttagaattgtaa
acactttggatagaaattgtccaaaaagcttttttttttgagatggagtcttactctgtc
acccaggttggagtgcagtggcacaatctcggctcactgcaatctccacttcccaggttc

Exon  8 +      14583      14689   0   Internal    107    92   Excellent
ttcagtctcaaaaaaaaaaaaaaaaaaaaaatgaaatgggacacagtatggaaagtgctt
gctctagtgctgggcatgagatgggcgctcaggacggtaagaaattattgttattcccta
tgtgacccagggacactagcattaaatatacaaagccgtcctttctattccttttcttag
CGCCTGAGACTTGAAGAGGAAACTGGCAAGAAATTGAACCCTTCATTTCTTGACTTGGTC
AGAACTCCTCAGATAAGGAAACATACTATGATATTGATGTACAACTG
gtaaggaatatttttcactttgaaatgcctccaaattgttttaatcacagtcatccatag
taaggaagggaagaaaacatgacctcatcccggtattagcgctgacggtgggcagcaatg
tgggttgtgtctggtaggttttcctgatcgtgtttttcttgggcaaatattaagatcggt

Exon  9 +      16342      16762   2   Terminal    421    99   Excellent
ccagccacagccagccactgaagtagatcagagattataaaagcagtgggatgggggact
agcaaggagatggtcacagggaaaggtgacctacaatccacattatttttccagaagcct
ctcttttttggtgccctgtgtttggtgcttgacttgacctgaactctcctctttgctcag
GTTCACGAGCTCTGTGCTCTACCAGGGCCTCATCATGCACATGGGCCTTGCAGGTGACAA
TATCTACCTGGATTTCTTCTACTCTGCCCTGGTTGAATTCCCAGCTGCCTTCATGATCAT
CCTCACCATCGACCGCATCGGACGCCGTTACCCTTGGGCTGCATCAAATATGGTTGCAGG
GGCAGCCTGTCTGGCCTCAGTTTTTATACCTGGTGGTAAGTTTCAGGTGAAGTTGGAGTC
TTATCTCCAAGACCCTGGAGAAAGGGAGTGTCACGGCCCATTGATAGGAAAACCATGTAA
TTTGTCATCCAAATCAATTTGGAAAGACAAATTGGAGGGCAGTATCTGGGACCCTTCTGA
GCAAATTCATATGGCCAGCCTCCCTTTAGGAAAAATTGTACCCAATTTTTCCTTGATGTG
A
tgtaacaagagagactttacagccccatgctacaggccatcaagatgacctggagcagag
agcatgggccttgggtaaagcaggcccaggtcaaggtcttactccagcccttcctgggtg
ttaactggggactctcttgacctccctgcatcaacctgcagaataaatgagaaaaatgta

Exon 10 +      17779      17834   0    Initial     56    86        Good
agaagtcatttttctttcttgtcccattctgggatggggaatttgtccttacagtcccac
tctggagcactgtctgaagatgaggaatcatctgtgtacggataagtactgttcttttcc
ctcttagatctacaatggctaaaaattattatctcatgcttgggaagaatggggatcaca
ATGGCCTATGAGATAGTCTGCCTGGTCAATGCTGAGCTGTACCCCACATTCATTAG
gtgagtgcattttccttagaatgacgagggtgggtgagacatttgttcattggctggaac
caccacaagtgcagacaaaggatatcttaccttcaaaacacagtgtaagggaaggtgaga
acacgtaaaggtccagccaggcccagcagttcacctctcacacttacaggctggggtaaa

Exon 11 +      18542      18654   2   Internal    113    88        Good
tgtatgaataagttcttcagtggtgatttctgagattttggtgcacccgtcacctgagca
gtgtacactatagctcttgaacattttaattatttgaggaagtgtttattcaggggtgga
tgggagataactactgcactgtgataagttaacaagttaaatcagtttcctgcattctag
GAATCTTGGCGTCCACATCTGTTCCTCAATGTGTGACATTGGTGGCATCATCACGCCATT
CCTGGTCTACCGGCTCACTAACATCTGGCTTGAGCTCCCGCTGATGGTTTTCG
gtaagaaatcttcacagatgtctttaagtgaaaacttatttttctagagaccttcacttc
tcttctacttcattcaaaacaggtgtcatgcctattagtaactactaattactactcata
gtagtaatgatgtgtctgtggcttgcgttcttcctggatgtgcctagtaattagtaatat

Exon 12 +      22965      23044   1   Terminal     80    51    Marginal
cagtaaagaaaaataagcaaaattatcccaagcaaactaaattagaaggctttccatgaa
cctggcaattgttgaaaccatgctgatatggggtcactacctgattccaatgagcccaga
attagaatattgatccagatttttatattacccatccctcttgtttcttctgaactgcag
GAATCACTCGTTGGAATGAGCAGGGTCAGTCTAAAGTGCAGGAAGAAAAGCTTAAAACAA
CTGATGAGACTAGAATATAA
taacaggtataccattgttcttgaaacataatttttctctctccagtttcccatttttgc
taaagacaaatcttggtaggactgatttgctttattgtacttggcctgattatttgtata
aagtgcagcaaaaataattatttttcacataggctttttaaattggctttgacaaaactt

Exon 13 +      25547      25625   0    Initial     79    54    Marginal
gagcagccaattctgagcttgcaaagtcttttaactgttcaagataatttttagggataa
atatgacatgaacccccaaattcctatctgttggatggtggaaaccaagagaaagaactg
ccatgtggttacaagttcaagctcccaaggacatttttcaacatgtggtctctgggcaca
ATGAAAGAGCAGACAGTTACCCTGAGTAACAGAAAAAATAGAAAAGAGAAAGGAGAGAAA
GGGAGAAAAGCATTGTCTG
gtggggcggcaggggcagctcctcctgtggcagggtggggaaggagaggtgctcagggag
gccagagaaagacccacccattacagtaacactgttcaggtgaccacttgtcggtagcga
agggatcttttccagcagtcctatccgctctcaagcgtccctcttaggaagaaataactt

Exon 14 +      26126      26181   1   Terminal     56    56    Marginal
gggtaggtaaaggaaaattacagtcaaagtgggtagttctcggcaggcaggggcgggggt
cacaatgtgctcagtgggggagcttttcagccaggatgagccaggagaaggaatttcaca
aggtaatatcatcagttaaggcaggaacaggccattttcaattcttttgtgattcttcag
TTACTTCAGGCCATCTGGATGTATACGTGCAGGTCACAGGGGATATGATGGCTTAG
cttgggctcagaggcctgacattcctgtctccttatattaataagaaaaataacaaaaaa
caaaatattggtaaagttttggggtggtgaaaattttggggggtggtatggagagatgat
gagtgatgtttctcagggctggttcgagtggaattaggggcagcgtgggaacctagagtg

Exon 15 +      26852      26965   2   Internal    114    71        Good
ttttaaaagaccattagtccattttacctttcctgaagattgaggatgataaggggtatg
aaggttccactgaataccaagagcctgagaaactgcttgggtgatttgactaataaaggc
tggtccgttatcagactgtatagaggtgggaaggccaaaacgaggaattatgtctgacag
AAGGGAAGAAATGACCATGGTGGCCTTCTCAGACCCTGTGGAAAAGGCCTCTACCCATCC
AGTGAAAGTGTCTACCCAGACCAAGAGGTATTTTAGTTTCCTGACTCGGGGCAT
gtgagtaaagtcaatttgccagtcctgggcagggcaaatccccgagcttgatgtgtagag
aagggagggggcctgagaaattcctggggagtagtggaatagcagatggaacactgagaa
gtgatttccttgaggatagatttccacgatggaaaggaaatgagaggttctaagagatgg

Exon 16 +      27699      27983   1   Internal    285    54    Marginal
tggaagtaaagcagctttgagaaatgttttttttttaaagaggcattaatgatggaggac
ccttgcatagtgagaaatttctttctgcccatatggtggtgcaggatatggaaggcatat
ttagagtcagtattaatattgatttgtagtccctttgcaagagtgagggcccaagttcag
GCAATGAGTTCAGCTTGCTGAGAGATAGTGGGGGGCAGAGCGGTAGCCTCAATGATAGAT
GTGGAAGATACTATAGCATAGCCTGCCTTTGCTGGTGTGTGGCGATTAAGCCTGGTGGAA
CTGCCATTGATAAACCAAGTGTGATCAGGGTGAGGAACAGGAAAGAAGGAAATATGGGGA
AATGGGGTGAATGTCAGGTGGATCAGAGAGATACAGTCATGGGGGTCAGGTGTGGTATCA
GGAATAATGTGGGAGGCCAGATTGAAGTCCAGGCCAGGAACAATG
gtaattgtgggagactcaactaagagtgagtatagctgaaggagccaggtgagaggaaga
aaatagattttggaaattatgagaactgtagagagtgagctgagcatagtttgggatttt
gagggcctctaaaagcattaacacagtggtagccaccacacacagacatgagggctaggc

Exon 17 +      31902      32004   2   Terminal    103    50    Marginal
agagggacttttaaccctctctgtcttagaagagactctaactcccctaaattgggcctc
taacccaatcacgtcctttacctgggtacgccagcacttacccaaagttaattaatcagt
gctgcagtctgtttcctttgcgctggcggaggggaggtctcctcagtatcctcccttcag
GGTTCACCAGAAAGATGTTATTGGAAAGGTGTCCGATCCAGACCCCAAGAGAGGGTTCTT
GGATCTCACACATGAAAGAATTCAGGGCAAATCCATAGAATAA
tgtgaaagcaactttattaaggaagtcaaggaataaagaatggctactccacaggcagag
cagccctgagggctgctagttgcccatttttatagttatttcttgattatatgctaaaca
aaaggtgggttattaatgagtttcctgttttttgaccatatagggtaacttcctgatgtt

Exon 18 +      35324      35427   1   Terminal    104   100   Excellent
gagtttggaactggtataatatttataatggaaaatacagcagtcagagatggcaaagga
atctgtaaataagtatagaaaaatgctaaaaaaaagttttaaacaaaaataagggaaact
ctaattatagaccttgagtttttcagttcttaatgtgatattcatctgtttggctttcag
GCGTGCTTGGCTTGGTTGCTGGAGGTCTGGTGCTGTTGCTTCCAGAAACTAAAGGGAAAG
CTTTGCCTGAGACCATCGAGGAAGCCGAAAATATGCAAAGGTAG
gcagttgaaagttctaaatgaattgttctataaaggttttaagacaaccctatagccatt
tggaaagaattaaattgactttatacttcacaccatacactgagataaattcaaactaaa
tcaaagacttgaaagcatcaaaaaaattagtaaaattacaaagacattatacgagaattt

Exon 19 +      40621      41874   0     Single   1254    86        Good
gtattacctcattgaatccttgcagcaaccctatgaaataggcgttattattattaaccc
cactgacaactggaaaaaaaaaaaaaacaggccagagaaagtaaaggacttgctcaaaac
cacacagccaatcagtgacaaagccaaagtttcaatcctggcagctagattttgtggccc
ATGAATTTGTCTCACCATCAGAGGGTTGGGCTCATGAATGGGACAGTGCGACGAAGCACC
CGTCGCAGTGCTTGGTATTTAGTTAGTAGTCACTCACCGGTGGCTGATGTTGTTGCTGCT
GCTGCTGTTGTTGCTGCTGCTATTGTCATTTTTCTTGTTGCTGTTGTTGCTGCTATTGCT
GTTGTTATTGTTACTGCTGCTATTGTTTTTGCTGTTGCTATTACTGTTGTTATTGCTATT
GTACTTATTTCTACTGTTGTTACTGTTGTTGCTGCTGCTGTTATAATTATTGCTGCTGTT
CCTACTGCTGCTACTGTTGTTGCTGCTGTTGTTGCTGATGTTGCTGCTGCTGTTGTTACT
GCTGGTGTTCGTACTGCTGTTGTTGCTGCTGCTGTTATTGCTTCTGTTGCTGTTATTGTT
GCTGATGCTGCTACTGTTGCTATTGCTGTTGCTGCTACTATTACTGTTGCTATTGCTGCT
GCTACTGCTGCTGGTGTTGCTGCTACTGTTGTTGCTACTATGGTAATGATTGCTGCTGCT
GCTGCTGCTGCTGTTGCTGCTATTACTACTGCTACTTCTGTTGCTGCTGCTGCTGTTATT
GCTGCGACTTCTGTTGTTGCTACTGCTGATTTTGCTATTTCTGTGGCTATTGTTGCTGCT
GTTGTTGCTCTTAATTGTGATGGTGTTGATTCTGTTGCTATTGTTGCTGCTATTGCTAAA
ATTGTTGCTGCTGTTGTTGCTATTGTTGGTTTTGTTGTTACTGTTTCTGTTGCTTTTGTT
ATTGTTGCTGCTGCTGTTGCTGTTGCTGCTGCTGCTGATGCTGTTACTGTTACTATTGCT
ATTACTGATACTATTGTTGCTGCTGCTGTTGCTCGTGTTGCTACTGTTGCTATTGCTGTT
ACTACTGAGGATCCTATTGTTGCTATTGCTGTTGCTGCTGATGGTATTACTGTTGCCATA
TCTGTTGCTGCTACTGTTACTGTTGCTGTTGCTATTACTATTGTTGCTGCTGTTGCTTTT
GTTGTTGTTACTGCTGCTGTTGTCACTGATGCTTCTACTGTTGCTATTGCAGTTGCTGCT
GTAATTACTGTTGTTGCTGCTGTTGCTACTATTGCTGCTACTGTTGCTGCTGTTCTTGCT
TTTGTTGTTCCTGCTGCTGCTTCTATTGCTGCTATTTCTACTGTTGTTGTTTCTGCTGCT
GTAGTTGTTGTTATTGTTGTTGGCAGAGAGACCAGAGGAGCTCAACTGACTTGA
ttttacctccccatctggagctttagagaattccaaaaccatagggtgatttgggtaagc
ttctgccatccctcgtctcagattggattggtccagaaaacgagacaatactaaccaact
ccaggtgggggaaattctgtgagatgctgggtggctgggagcagcccacagctgattcaa

--------------------------------------------------------------------------------