--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (23588 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1256       1354   2   Internal     99    51    Marginal
gaagctctcggcggctgtgctagcaatctgggggaaagccctgggctcggccaggtggtg
ttggccacgttggccacgcccccacttcgcgcagccgagtggctaaggaaatcttaagca
gggaggggaagccagacggttaacacagacaaagtgctgccgtgacactcggccctccag
TGTTGCGGAGAGGCAAGAGCAGCGACCGCGGCACCTGTCCGCCCGGAGCTGGGACGCGGG
CGCCCGGGCGGCCGGACGAAGCGAGGAGGGACCGCCGAG
gtgcgcgtctgtgcggctcagcctggcgggggacgcggggagaatgtggactgggtagag
atgaacgagacttttctcagatgttggatatttgcttggaaaaacgtgtgggtacgacct
tggtaaggaacttgaattttttttttttaattctgaaattgatctgaaaactttattttc

Exon  2 +       3049       3330   0    Initial    282    90   Excellent
tttttttttttttaactaagagtagcatttaaaaaccttgcttcttttcaaggcagttta
ctttatacggcttcttggctctttctcaactgtaccaagcactctgcatctgcttttaaa
gtcttcagactactgtattagtcatagcctctcagaaggagccacaggaacggcgggaca
ATGGGGATTAAAGGCCTTTCCTTTCTCTTCCAGGCTGCCCCCAAGTGTAACTCCAGCACT
GTGAGGTTTCAGGGATTGGCAGAGGGGACCAAGGGGACCATGAAAATGGACATGGAGGAT
GCGGATATGACTCTGTGGACAGAGGCTGAGTTTGAAGAGAAGTGTACATACATTGTGAAC
GACCACCCCTGGGATTCTGGTGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTA
CCAAGGAATCTGCTTTTCAAGTATGCCACCAACAGTGAAGAG
gtaagcctctggtttattgacaagaagattggggacctggtgccaaatctccctacttgc
ccttgaggccttgtatatctctgaaaacctctgagaatctgtaagtatcagtaaataatt
gattgctctattcaattcttgcattgctttctctttccctaaaccatttccttctcattt

Exon  3 +      10496      10619   0   Internal    124   100   Excellent
gatggtctccccctatggtgaagcttgttaattatgtaggcatcattaatgtctgtttac
ttatcaaaattttatcattgttagttgtattactacttgacagtccaatttatttaattg
aaaagattggttaacattttatagtcaaagtaattgtttcctgtgttttttcctgtttag
GTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACCCCTAATA
GGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTGGAGG
GTAA
gtaagggaaatttcttcagacccattaaatgttaggaaaaaatggagctaaaagagctgg
gtggctcacctttctcatcctgtgctgagaaatgctggggctcacccataagtatccagc
atccccatggacacagggaattctgaacaaatgtgatgaaaccgatgaaatgtctggcct

Exon  4 +      10711      10799   0    Initial     89    57    Marginal
gggcacacgttttggacccctaataggtgaaatctacaccaatgacacagttcctaagaa
cgccaacaggaaatatttttggagggtaagtaagggaaatttcttcagacccattaaatg
ttaggaaaaaatggagctaaaagagctgggtggctcacctttctcatcctgtgctgagaa
ATGCTGGGGCTCACCCATAAGTATCCAGCATCCCCATGGACACAGGGAATTCTGAACAAA
TGTGATGAAACCGATGAAATGTCTGGCCT
gtaggtggttagtgatggagatacgggctatatgtgaatcttgatttttgcaattcatta
gagctttgtaatgaaaggaaacagtttgttgcttgctttaaggataggttcatttgcatt
tctccgcaaggaagtagtaatgagttaccaagccttagatttcacccctttttgatttct

Exon  5 +      12171      12256   0    Initial     86    56    Marginal
aatttttatttaataattattcctccttaaaatatattaatcacctgacttacaatggtg
gaaccatgagtgcatttttgcctttattgtcaataacgtcttctcagaagtgagccacaa
aggtgcatagttcttggagttaaaggtctgaattaagacaatccagcataagtctcatta
ATGTGTGATTATTTTGAGAAAAGGCAAGAAGTACCTAAGAATCTCCCCCTCACTGTCCAG
TTCCCTGTTTCATTTAAAGATTCACT
gtaagtaactgaaaggctttccttgggaggatttatttgaatcagtctttcacatgcaaa
ggatattgtagaacatctcgtttttgctggcaggaatatgaacatctgttgtgaggaaag
aaaaagtttcatgcaaattacactgccaaagaagggatgttcaagttgagaaaccagtga

Exon  6 +      14181      14433   0   Internal    253    88        Good
tgtttccgccctgatttctgctgattcaagactattctggctaaactgattggattcttt
ttctaactaggcagtaggggatcagaaatcacacacggtaccggctgtgtttattctgag
aggtgctggggagctttgggtctgacttccttttacatgcctgtcttctcttttggacag
ATCTATTCCAGAGGGGAGCTTCACCACTTCATTGACGGCTTTAATGAAGAGAAAAGCAAC
TGGATGCGCTATGTGAATCCAGCACACTCTCCCCGGGAGCAAAACCTGGCTGCGTGTCAG
AACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTT
GTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACA
ATGATGAATCTCA
gtaagtggattacagaacaaaaaaataaaaaatgccagtaatgtcggttctgcccctttg
aactaataacatgttgtttaattatacggctttgtcatgtgttggatgaagtaggtggct
taagctagggactaggaagaggaaaaacattttttgagtccctattaactattaggaaac

Exon  7 +      19706      20814   1   Internal   1109    73        Good
ctgcacttttgagtgagtggcccagagccttctagaatgagagtgcgttggaagccagat
atgtggcgattgtgtcgccagctgttactcaggttttctcaagaaggaggagcaactttg
gcagttttgcttcagttctctctagccctctgtgtaatcgcccctttttctttatttcag
CACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCCAAAGA
ATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCTAAAATTGGACTCCAACCCCTCCA
AAGGAAAGGACCTCTACCGTTCTAACATTTCACCCCTCACATCAGAAAAGGACCTCGATG
ACTTTAGAAGACGTGGGAGCCCCGAAATGCCCTTCTACCCTCGGGTCGTTTACCCCATCC
GGGCCCCTCTGCCAGAAGACTTTTTGAAAGCTTCCCTGGCCTACGGGATCGAGAGACCCA
CGTACATCACTCGCTCCCCCATTCCATCCTCCACCACTCCAAGCCCCTCTGCAAGAAGCA
GCCCCGACCAAAGCCTCAAGAGCTCCAGCCCTCACAGCAGCCCTGGGAATACGGTGTCCC
CTGTGGGCCCCGGCTCTCAAGAGCACCGGGACTCCTACGCTTACTTGAACGCGTCCTACG
GCACGGAAGGTTTGGGCTCCTACCCTGGCTACGCACCCCTGCCCCACCTCCCGCCAGCTT
TCATCCCCTCGTACAACGCTCACTACCCCAAGTTCCTCTTGCCCCCCTACGGCATGAATT
GTAATGGCCTGAGCGCTGTGAGCAGCATGAATGGCATCAACAACTTTGGCCTCTTCCCGA
GGCTGTGCCCTGTCTACAGCAATCTCCTCGGTGGGGGCAGCCTGCCCCACCCCATGCTCA
ACCCCACTTCTCTCCCGAGCTCGCTGCCCTCAGATGGAGCCCGGAGGTTGCTCCAGCCGG
AGCATCCCAGGGAGGTGCTTGTCCCGGCGCCCCACAGTGCCTTCTCCTTTACCGGGGCCG
CCGCCAGCATGAAGGACAAGGCCTGTAGCCCCACAAGCGGGTCTCCCACGGCGGGAACAG
CCGCCACGGCAGAACATGTGGTGCAGCCCAAAGCTACCTCAGCAGCGATGGCAGCCCCCA
GCAGCGACGAAGCCATGAATCTCATTAAAAACAAAAGAAACATGACCGGCTACAAGACCC
TTCCCTACCCGCTGAAGAAGCAGAACGGCAAGATCAAGTACGAATGCAACGTTTGCGCCA
AGACTTTCGGCCAGCTCTCCAATCTGAAG
gtaggccttgagagagagcagtccaaggggctgtgagtgcatgcttgtgtttgtatttag
cttgctttccatggggtatcgattgcatttgcagtagtatgagcccccggttggggatag
tgggtatggattccgcctggcttttgccacttctagctctttgactttggacaagtgact

Exon  8 +      20653      20814   0    Initial    162    89        Good
ttgctccagccggagcatcccagggaggtgcttgtcccggcgccccacagtgccttctcc
tttaccggggccgccgccagcatgaaggacaaggcctgtagccccacaagcgggtctccc
acggcgggaacagccgccacggcagaacatgtggtgcagcccaaagctacctcagcagcg
ATGGCAGCCCCCAGCAGCGACGAAGCCATGAATCTCATTAAAAACAAAAGAAACATGACC
GGCTACAAGACCCTTCCCTACCCGCTGAAGAAGCAGAACGGCAAGATCAAGTACGAATGC
AACGTTTGCGCCAAGACTTTCGGCCAGCTCTCCAATCTGAAG
gtaggccttgagagagagcagtccaaggggctgtgagtgcatgcttgtgtttgtatttag
cttgctttccatggggtatcgattgcatttgcagtagtatgagcccccggttggggatag
tgggtatggattccgcctggcttttgccacttctagctctttgactttggacaagtgact

Exon  9 +      21252      21429   0   Internal    178    87        Good
gcctgtgatttttgtgcttttaagaaaaacaccattctgaaaacatgaagatttcttctt
tttaagactgtcttgatgcttttcttaagatatttgcatcaacacttgagtcttggagca
gaaatgttaggtctcagagccagcttgagagcagagctaacacatgtggcttcttcccag
GTCCACCTGAGAGTGCACAGTGGAGAACGGCCTTTCAAATGTCAGACTTGCAACAAGGGC
TTTACTCAGCTCGCCCACCTGCAGAAACACTACCTGGTACACACGGGAGAAAAGCCACAT
GAATGCCAGGTGCGCAGTATTTTCTGGGTAGACCTTCTGACCTTTGTAGAAAATGTCT
gtgagtcaccctcccatgtcctatatagcccgtagttaaagccaacaccagattctgcgt
tgtcccatcctggactgatggcactatggtccttcccagtactttgtatctgctgatgac
ttgagatggcacagccagcttccagtgggtgggaaaatggtaggggaaataaacagcccc

Exon 10 +      21792      22367   0   Terminal    576    96   Excellent
gtgtgctgtgtgcccacatccccccgtttgcttaataccacactggaggtgccacaagga
ggcttctcacctcctaggttgctgggcgttggccggtaagcctgcccctcccgttggcaa
ctcttaatcttctggccttcctgtctcccttccctgctgtctctctcccctacactgtag
GTCTGCCACAAGAGATTTAGCAGCACCAGCAATCTCAAGACCCACCTGCGACTCCATTCT
GGAGAGAAACCATACCAATGCAAGGTGTGCCCTGCCAAGTTCACCCAGTTTGTGCACCTG
AAACTGCACAAGCGTCTGCACACCCGGGAGCGGCCCCACAAGTGCTCCCAGTGCCACAAG
AACTACATCCATCTCTGTAGCCTCAAGGTTCACCTGAAAGGGAACTGCGCTGCGGCCCCG
GCGCCTGGGCTGCCCTTGGAAGATCTGACCCGAATCAATGAAGAAATCGAGAAGTTTGAC
ATCAGTGACAATGCTGACCGGCTCGAGGACGTGGAGGATGACATCAGTGTGATCTCTGTA
GTGGAGAAGGAAATTCTGGCCGTGGTCAGAAAAGAGAAAGAAGAAACTGGCCTGAAAGTG
TCTTTGCAAAGAAACATGGGGAATGGACTCCTCTCCTCAGGGTGCAGCCTTTATGAGTCA
TCAGATCTACCCCTCATGAAGTTGCCTCCCAGCAACCCACTACCTCTGGTACCTGTAAAG
GTCAAACAAGAAACAGTTGAACCAATGGATCCTTAA
gattttcagaaaacacttattttgtttcttaagttatgacttggtgagtcagggtgcctg
taggaagtggcttgtacataatcccagctctgcaaagctctctcgacagcaaatggtttc
ccctcacctctggaattaaagaaggaactccaaagttactgaaatctcagggcatgaaca

--------------------------------------------------------------------------------