--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (22834 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1240       1315   0    Initial     76    64    Marginal
cacccgcaggcaggtgtgggcgacgccagcagcacacggggaagctgggcacgtggggcg
gaggcagctgcctggtttccatgtgtgcgccctttaagacccggcggcgcgacggaagcg
cgtgggcagcacgtgggcagcacgtgatagcgctgggcgactccgcggagctgcacggcc
ATGGACGTGGGCGCCGACGAGTTCGAGGAGAGCCTCCCTCTGCTGCAGGAGCTCGTCCAG
GAGGCCGACTTCGTGG
gtgaagagcctgggattcgcggctgtgccggacagagccccttgccccgggcgagcttga
ggagggggtggcgggacggttgccaggccacagggcctcagagagggcctcgggaaggac
aggggggcttccttctccagccccggggcggtgggactttgagcagcaagtacactccga

Exon  2 +       6915       7015   2   Internal    101    72        Good
attgtttggcttcctattgcataagagcctcagagaagaaatcgtcttcttttggtacat
tttctttgtatattgcaacatgaaaaccagagggttcagaaactgctctcatgttaacat
agtcttgcggttctgaagtgtttttctctgacatgttcactttcatgcgcccattttcag
CTCTCCGGATAAAGACCAAATCAAGGTGGTGATTGACGAAGTGACGCGGTGGCTGGAGCT
GGCCAAGGAAGGCGACTGGATGACTCTTCCTGGGATCACTG
gtaggcagggcctgttcctcccaacgcaggagcattgggacaggtcactgtcacctgcca
ggagttgggggaaacacaccctttcttgggatcctggtcccaagtgcctcatgactgagt
ctgatgcaagcatttgtttggcggttacggagtctttgtggttaaagttctgacctgcat

Exon  3 +       9672       9776   1   Internal    105   100   Excellent
tgccccagatcccatcatgacaggccaggccctgccacatggctcatgggcttgggcacc
cttcaagctccctttccacttgacctttccatctcagcttctgctcctccagggcttctc
ttgtggggaacatgccacacggttccaggtgctgtgtgcccctgtgtttccctgctgcag
GCTTCCAGGCCTTTGAGGTCCAACTGGTGCTGAGGCAGGCCCTCCCCAACATCTGGACGG
TGCTGAAAGATGAGGGGGTGAGTTCTCACTGCGAACGGGGCATCA
gtggctccattgtttctctctcataattggccaaatctggcctctgaaaagcttttatct
tgcacgctgctagtttttccccctttccttttgtttagagatgcagagccatttctttag
gcctcattcctagtaacccaggattcagggaatttgtccctgcttttcaggtggtagtga

Exon  4 +      12633      12718   1   Internal     86   100   Excellent
tggcagcttgatctgagtttagaaatccttagtggctaggattaatggtgttttcaattc
ctgttttgtttcagtttgctttattaatcagtgccagtggcaagctaggttcaagaatgt
tccttcccatttttgccaacaaacaaattcactcttgactacctgggtttttcccctcag
AAAGCTACGATCAATTTAAGCAGAATATCCACAGCCTATTTCCTGTTCTCATTGATACCA
AGAGTGTAACAAAGGATATCTGGAAG
gtaatgaatagaactgctttgggttaagaactgctttttccataccagtaacacttagct
ttctcttgtggggtttttttcttgtgtttttttgttttttttgttttgttttgttttgtt
ttgttttgtttgagagggagtcttgctctcaaagccaggctggagtgcaatggcgcgatc

Exon  5 +      14533      14588   0   Internal     56    84        Good
atactgcgtaccctgacatcctaactaaggaataaggatggttgcaccatttgaagagaa
agaggaggttgtaggagtgagcattttccaggccattttaatgaccatttggtactgcct
gaaacagagaataaacaaaagcgcaaatgttttcctctggtttgttttccatgattgtag
GAGATGAATTTCCCGAGGGTGTCGAATCTTTCGGAAGTCTATGAAGTCCTGAACAG
gtgaggacggcgattcctggagctactgctggagcggccttggtggcctccctgtgctcc
gcaggcctttgggctctctaggcgtgcccaccattcacagtgatgcctgcttgggacttg
gtctcctccagctcctcctgcttcatggcccccttcctccgatgaccctcttgcctccgt

Exon  6 +      19232      19355   1   Internal    124    97   Excellent
ctgcgctcaggtgtgtgtgctccctggacagagggggcactggcagtgggaggaggctgt
gggatgagggatgcccttttggaatcaaaggtgatgtcttaccaaggggggacagcatgg
ggctttctctgaatagtggcctcgcactgattctctgagcctattgctgtttgtcaccag
TGGGACCCTCACCAAACCATCACCAGCAGATGGTGACTGTCTGGAAGCTCTTCTTCTATG
TGGCCACGGAGAATGCTTTTAGACTTGCCAGCTGGGGAAGCACCCAACCAGAGCCCCAAG
ACTT
gtgagggcaggagggagggagagccgtccgagggagtgtccttctgttctgtcaccggat
tcttggctgtggccgaggaagtggatgaacttctgtgcgcccgacagctttggggttttc
tgtccttgcagcatcgaccccgtgcccgagtcatcctttcctcagtaccttgacgtgctg

Exon  7 +      19487      19586   2   Internal    100    72        Good
cttttagacttgccagctggggaagcacccaaccagagccccaagacttgtgagggcagg
agggagggagagccgtccgagggagtgtccttctgttctgtcaccggattcttggctgtg
gccgaggaagtggatgaacttctgtgcgcccgacagctttggggttttctgtccttgcag
CATCGACCCCGTGCCCGAGTCATCCTTTCCTCAGTACCTTGACGTGCTGGCTCCTTACGT
GAACCAAGTGAACCTCATCCGAGCGGGGGTCCCAAAGATC
gtgagtagatctcatttggccccctcgccccattcagagttcagaggctttgctgggaag
cggccagtgctctctgggactcgtgagagggatttcggtggtcggtgagatgagagctgg
gtttttctttcctctcatgtttctccactaaagccaacatggactcatccttccttctct

Exon  8 +      19878      20057   0   Terminal    180    48    Marginal
gagagctgggtttttctttcctctcatgtttctccactaaagccaacatggactcatcct
tccttctcttcccctccctgccccaagcagagcctttcctagtttcttttgagatcttca
gactggataagaagtcaggaagaactgtggaaaatctcttgtgttctgcatgttttctag
AATTTTTCTGGTCCAGATTATCCCAGTATCCGACCTCCCATCCTCATCCTCAGCGTCAAA
AGGTGGCCTGGGGTCAGCGAGCAGCAAGTCTACCATAAGTTTCAGAATCTCTGCAAGTTT
GATGTCAGGCGACTCACAAGAAGCCAGTTCTTACTCCTGACCAATAAGTTTAAGGAGTAG

gtgcctctaagtccgcgtcccccacccctcgtgcgttcatccctgtatctctctgactcc
acccgcctgatcacagcaggcggcgccatcctgctgcctggctgaccacagcaaacttgt
tttggcagtgcgcggaacatcctgaaggagtaccgggaccacccgaccctgtgcatctcc

Exon  9 +      20169      20284   0   Internal    116    89        Good
tgcaagtttgatgtcaggcgactcacaagaagccagttcttactcctgaccaataagttt
aaggagtaggtgcctctaagtccgcgtcccccacccctcgtgcgttcatccctgtatctc
tctgactccacccgcctgatcacagcaggcggcgccatcctgctgcctggctgaccacag
CAAACTTGTTTTGGCAGTGCGCGGAACATCCTGAAGGAGTACCGGGACCACCCGACCCTG
TGCATCTCCCTGTACCGCTACTGGAGGCACTCCCCAAACGTCAACTGCCTGCTCCA
gtaagtgacaggctgaggccacctgcctgtcctggggtcctggagtgcccggggtcccag
catcccagcatggtctgactcgagcacagctcacttgctggtgtgtgttgccaagggggt
tgtgttgacgagtgtggtgccctgaatgtccttcagtgatgccgcgtgtctgtcgagcac

Exon 10 +      20830      20943   2   Internal    114    72        Good
aaggagctgatgggggtcttcattagagacttggagtgagccaggcggagggggcagcag
gacggagccttccagtcaggaggtgcccggagtgtcacggggagaggccattgtgagcaa
aacagcaaggagggggatgcaggagaaggaaccagtgccccccagctgggggccacccag
GGAGGACGTGGGCTTCTCTCAGGAGAGAGGGAATCGCGGAAGTTACAGCAAGAAGGTCTA
TAACCCGACTCAGGTTGTCTTCCGTGTTGGGGTAGACTGTGGAGGCGAGACGCT
gtgagagcagtcaggaaggagatgcttcagctgggtcacagctcggtgcagccaggggca
gcggggtggagtcagcgacagaccagagaaggatcaagtacgaatccagggtttgagtcc
tgaacagctggaaaggcagagttgctgtcagttgagctgggtgaggttctggcttgcggg

--------------------------------------------------------------------------------