--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (22380 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        960       1259   0    Initial    300    47    Marginal
gcgctgaggccagcggcggagctgtggggggcaacggtgctgaggcggtggccgcggccg
ggcgggttgggctgacgtgagaagcgccgccgccgctgggcctcctccattccggcccgc
agccccgcgccctcccagcctttggcgccctcccgcgcgggcggcgcgctggcgacggcc
ATGGCGGTGGCGGCGGCGCTGGCGGGCCGCGGGGCGCGCGGCGGCAGGGGCCGGCCCCCG
GGCGGGCGGGCGGAGGGGGCGGGGCCGGGGCGGCGGGGGGCCCGCGCGGCGGCGGCGGCG
GCGGCGGCGGCAGCGGCGGCGGCGGCCGGGACAAGGCGGAGGCGACGGCGGCGGCGGCGG
CGCGGGGCGCTCGGGCTGATGGCGGCGGCGGCCGGGCCCGGGGCTGCGCTGTCCCCGCGG
CCGTGCGACAGCGACCCAGCCACCCCCGGAGCGCAGTCCCCGAAGGTGAGGAAGCGGCCG

gtgcgacccgaccctgaccccgtcccgggcctgggtgccggggcgtgggcccagtcccac
cggcggccgcccagcgtctcgggggcgtgggcccaggccgggcgccgcgcctgagaccgg
gggtggtcggcgaggcggggccccgaggtgagcccgcggcctctagcgagcaacaagtgc

Exon  2 +       7189       7266   1   Internal     78    98   Excellent
gtatcttgctgagttttatttcttgaatttataaatttttttgtagcccctttaataata
tttggaatatgtaatatgaatactttaaaaagtcaaggtttttaagcttttaaaagtttt
acaagtgcataaggttttgctgtttttaatagtcttttgatcttttttttggagatttag
AGCGACGAGATTTGTCTCACAAGGAGAAACTCTACCTGAGAGAGCTAAATGTCATTACTG
AAACTCAGTGCACTCTAG
gtaagaatagctttttaatgtgaatttttcaagctgaacatttatgagataatactagat
aagtatcttatttcctaaaatattttacaaaattaataaaataaattgaactatttaaat
gctacattatttacttcatttttgattattgttaaaatacacaggagaatgaagcttgaa

Exon  3 +       9001       9134   1   Internal    134   100   Excellent
tcgagtttatattgtgaatattaagtttaattattttcaaatgtactaagatattttgct
ttggctattggaaaaccattacaacgtggagcggtttgaagaattaaattttgaagagtg
cttttgttcacttatccttaaaagagcttctttatttttttattttttggtctaaaatag
GCTTAACAGCATTGCGCAGTGATGAAGTGATTGATTTAATGATAAAAGAATATCCAGCCA
AACATGCTGAGTATTCTGTTATTCTACAAGAAAAAGAACGTCAACGAATTACAGACCATT
ATAAAGAGTATTCC
gtaagtaattgaggtgactggcattttttatttgggttggggaaaatgacattttagaaa
gttatatgtgacttccaactgtattttttttttccagcaaatgcaacaacagaatactca
gaaagttgaagccagtaaagtgcctgagtatattaagaaagctgccaaaaaagcagcaga

Exon  4 +       9232       9381   0   Internal    150   100   Excellent
atccagccaaacatgctgagtattctgttattctacaagaaaaagaacgtcaacgaatta
cagaccattataaagagtattccgtaagtaattgaggtgactggcattttttatttgggt
tggggaaaatgacattttagaaagttatatgtgacttccaactgtattttttttttccag
CAAATGCAACAACAGAATACTCAGAAAGTTGAAGCCAGTAAAGTGCCTGAGTATATTAAG
AAAGCTGCCAAAAAAGCAGCAGAATTTAATAGCAACTTAAACCGGGAACGCATGGAAGAA
AGAAGAGCTTATTTTGACTTGCAGACACAT
gtaggataacttaaatttagtaccccctgaacttagtttattacttgttattgcagagtg
cccatcaccccctttatcgttattttttgtaccacctatgtgtgtgtgttttttttgttt
gtttgtttgttttgttttgttttttgtggcagagtctgtgtagcccaggatggagtgcag

Exon  5 +      10247      10395   0   Internal    149   100   Excellent
caataatatatagaactgaaagcaccaactgtcctcttaggttatagctcctgatatctc
ctaaaattttagcttttcgagggggaagtgggcgtgcagtggtgagcacgtggggactct
tcctaaagccttgattcttagcatggaatcagttttgtgtttctctttatgttaacgtag
GTTATCCAGGTACCTCAAGGGAAGTACAAAGTTTTGCCAACAGAGCGAACAAAGGTCAGT
TCTTACCCAGTGGCTCTCATCCCCGGACAGTTCCAGGAATATTATAAGAGGTATTTAGTA
GTTTTAGTTACAGTTGGTATCGGCTATTG
gtaaggggtttcagagccttttgtacttgcctcctaacaattttggggtctatagatatc
accgtaagatatcgtataggatttgtgttgctattcttctctggttctgtggtaaacaat
accctgtagtcagaatttgaatatatgctggtgaagtctagatgcctctgtctctgccca

Exon  6 +      12550      12703   2   Internal    154   100   Excellent
gaaaagatgttcaggctttttattaaccctacttgatgacaaaaatgaaaaattagtact
ctagttttcaaaagtcttcggggttactcaagaagtttaaggctatcttcataggtcaaa
gatgagtctgtttatatttaataataaagggaaaccaaaaataaactctctgaacttcag
GTACTCACCAGATGAGCTGCGGTATCTGCCATTAAACACAGCCCTGTATGAGCCCCCTCT
GGATCCTGAGCTCCCTGCTCTAGACAGTGATGGTGATTCAGATGATGGCGAAGATGGTCG
AGGTGATGAGAAACGGAAAAATAAAGGCACTTCG
gtgagaacatttctctctagtaggaagcatttcctttctctttgaatttttgttacattg
aatttctgtcatcaccctctccttgaaaaaggatggttgcatgtaatttccagaaagtat
tcatcaataaaagttacttatagtatgttttgataaaaacaagcagtgaatggcctttgg

Exon  7 +      13157      13268   2   Terminal    112    83        Good
ctgtctctttagcttaaaatattgaacaaaacagaatttgatctcttgacacagaaatgt
agttttcttagttgaggggagtgcatttgcttaatcttatgcttcctataggaaaatatt
atgtttagtaatatgttgtacaatttgttgggttttcctgtatgacttttttttttgtag
CAAAATGCACCTGCAAGACAGTGGGCAGTTGGTGTATTCTGTGCACCTGAAGGAGAATAA
AATCCCAATGATGGTTTGGGGCTTTGATCCCAGTGATGACATAGGGCTTTGA
atttctttagcattgtgttttaagtaactggctatttcaaacttttcattgaagccaatg
taaatgtgagattgtgctaccattgaatggacattatttccttgtcaccaacagcttcta
aaacatctttaataatacatattatgcaaaataagatactgttcaagtattaaagtggtg

Exon  8 +      14698      14853   0   Internal    156    85        Good
tttaacataacttactttagtctccactggaaaaagctttcttacatttagaatgatctt
tttatttttaaaatgataaagctttaaaactttctttgaatattttccatagttttcaaa
atccagactcaaatttgtcttaattccaaagaatctttgtttttgccttttaaactccag
GACAGCTCCTCTGGCAATGTATCTGAAGGGGAAAGCCCTCCTGACAGCCAGGAGGACTCT
TTCCAGGGAAGACAGAAATCAAAAGACAAAGCTGCCACTCCAAGAAAAGATGGTCCCAAA
CGTTCTGTACTGTCCAAGTCAGTTCCTGGGTACAAG
gtagaagaaaaaagcccctgactcagcttctttactgaccagcctctccctgaaatattt
taacttgactttcacgattgtggagcttctgcctgctgtacctcactagctgttcttcta
tggtgtgccctttgtccgctgctttcttttttgctttatttccttggtggcttttctgtc

Exon  9 +      19365      19473   0   Internal    109    93   Excellent
tgctttcttcagtaggcagtcttacattgtaggcagactcctgtcaagttttgtctttca
aaatggtcctcattagcaagttaccaaaagtaaaaatagggcaataaagtaacagaattc
cttttaaacccatagtaagctcttctggcatgaatttatagccctcttctacccttccag
CCAAAGGTCATTCCAAATGCTATATGTGGAATTTGTCTGAAGGGTAAGGAGTCCAACAAG
AAAGGAAAGGCTGAATCACTTATACACTGCTCCCAATGTGAGAATAGTG
gtaagtattgaaatgtctttttaaaattttaaccaccgtatttattggttcaaaaactag
aatttatagtttcaggcagatttcaaccaaagagtcaccaaattaaatacacagggtagc
ttgtgaggcatagacacagcccatgtgttttcctctacattgtatattcatttctctttg

--------------------------------------------------------------------------------