--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (26705 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        436        594   0    Initial    159    42    Marginal
ggaatctgcactttcaacaggtgtttggaactgtcccgctgcaggtggcaggcagacacc
tgcagacgctctgcaagcctgaattctgggaaaggctggggcccggcttccaatcccacc
cggggctcgggcttgggcggagccagacgctgcggcgagagaggccgcagtgccagcagg
ATGGGCTCCGAGTTCCCCAGCGCCAGTCGCCACCCCTCGGTCCTGGACTCGCGGACCGCC
CCCCCCCAACACCGCGGTGGCCTTTTCGCTTGGGCCGCATTCCAGGGCTCCGGACGTTTA
CGATTCACTGGCCTCTGCCCCGAGGGACCCAGGATAAGG
gtagggggtgtctcagaggtcattaaataaaagatgtttacagtgagctgggggaagggg
gtacccggggagacggcagccggagaaggcttcccagattcaaaggtttgggagatgacc
tcgacgtcggagagggggatgcgggccgccggcggcgctcactgtgggcgaggtcgccct

Exon  2 +       3348       3584   0    Initial    237    49    Marginal
aatctgctatctgccctgagtctgcccaggagtggacataccaagttggacaacatcttg
taggtaattctaacccacaggacttactctcctgcccattgctctgtcaaacatagggtt
ctttgaggaggttcaggatgagacagacctattcgtttggggtggcagtttttgaagcaa
ATGGTTCTTAAGAAATTACTTGTTATGCCCGAAACAATATTTCTTAATTTTGTAGACATG
GATTTAGGTGCTATTACAAAATACTCAGCATTACACGCCAAGCCCAATGGACTGATCCTT
CAATACGGGACTGCTGGATTTCGAACGAAGGCAGAACATCTTGATCATGTCATGTTTCGC
ATGGGATTATTAGCTGTCCTGAGGTCAAAACAGACAAAATCCACTATAGGAGTCATG
gtaacagcgtcccacaatcctgaggtaatgggtttagtgccctgataaagcagaccatta
tttacaagaccaagccttagtgtctgagcaaattgacctaaagtacaaattctaattcta
ggaatgtgccttctcatttatatgtgctttggatgtgaaacaactttttttttttaagag

Exon  3 +       5032       5162   1   Internal    131    60    Marginal
tgtaacctcctcttcccccaaacaagggcattgcttgtccaaatatgtgatcattataaa
tgtgtatatgtctaaatatgtaagtcaccataattgattgactgattgacttctaggaag
accctcacatttattgctagttccagaggcacttctcaaaatgattctcttttctttcag
GTGACATTCACTGTGAACTACACTTTCTTTCCACGAATTTGAGCAGAACAGTGTTGGGAG
GCAGTTTTCAGTGTCTGTCCTACCCGCTGGTTGACAAGCTGGCTAGTGTGTTCTTGGAGT
TCCGAGTCATA
gtgagaaggatctctgtgtgcccttattctgctccacttgtgccctagtcagtttatgga
tagtggatgcacagatcacagccttttacaaaggctagtgtggcatagtgtttttaggcg
agtaagatagacttgctgttttaatatcagtactgacatttgttagctgtatgatcataa

Exon  4 +       5658       5803   0    Initial    146    67    Marginal
ccagtattaatatttggtgtttattgttgaagctgctcagccatcactgtctttggttga
agggaaacagcttttgagttctgttctcaactcagcctcatgagtatgcacagattgctt
attgtttgtttttcttttaaggaagacaatggtgtaaaattggttgatcctttgggtgaa
ATGTTGGCACCATCCTGGGAGGAACATGCCACCTGTTTAGCAAATGCTGAGGAACAAGAT
ATGCAGAGAGTGCTTATTGACATCAGCGAGAAAGAAGCTGTGAATCTGCAACAAGATGCC
TTTGTAGTTATTGGTAGAGATACCAG
gtgatgataagagttactggtaaaaaaaaaaacctttgggaacgtgatataaacgattgt
atcagttttaatccaagacaaatggaaagaagtaaagtggaactaccctgagttgcatgt
ctacctgcctggcctttctagtaggatgtagtagctaagtcactactgcagcttggggtt

Exon  5 +      11432      11572   0    Initial    141    99   Excellent
taatgattggttttttggcttcttatagtcatttatatttctttttaagatcatttttat
gttttctaagatgtctgagatgacacaaaaggatttgtcaccctgaaattcctacacatg
aatgcatttaaacttttttctctttgttaagaaatgcggtgaattgctttttgtatttct
ATGACAGATTATGGCTTGTTAACAACACCCCAGCTGCACTACATGGTGTATTGTCGAAAC
ACGGGTGGCCGATATGGAAAGGCAACTATAGAAGGTTACTACCAGAAACTCTCTAAGGCT
TTTGTGGAACTCACCAAACAG
gtgaaaagtttattgaacatggttaaagttaaacaaatgaataaagtaacatggtctact
gaacaaattatcttgtttgtcatgcctcctctttccttttccaaagatgctgcatatctc
cttttttgtttttctctagggctacacaaggttctggtctatgtatcctgctaacttaca

Exon  6 +      12486      12681   0   Internal    196    88        Good
ttactttagtgttttataattttaaaaattgaaaaatgaacacaattataattgataaaa
tttaaaaattaaaatgagttaactaaatatttacatatgcacatatgtatatatgcttta
tatttcacatttatttttataacttgaaatttttcttccatgtgtctttttcctttgtag
GCTTCTTGCAGTGGAGATGAATACAGATCACTTAAGGTTGACTGTGCAAATGGCATAGGG
GCCCTGAAGCTAAGGGAAATGGAACACTACTTCTCACAGGGCCTGTCAGTTCAGCTGTTT
AATGATGGGTCCAAGGGCAAACTCAATCATTTATGTGGAGCTGACTTTGTGAAAAGTCAT
CAGAAACCTCCACAGG
gtatgtcgtactagcactgcaaaaatttgtttttaatgctctttgaagccaatctcactt
ataaactaaggtggtaaagtgagttaagaatcttgcagctattcctggctctgccacatt
tagacattgagaagtcttcccactctcagagccattgaaacatggtctgctctctctgcc

Exon  7 +      14450      14607   1   Internal    158   100   Excellent
ctttgcagtgaaagaatttgacctgtaaaaaccactaataaactatgtactatttaaaga
ttatacactatttaagattaagacattgatttttaggtggataattttaagagaaaattc
taaaactctttataataaattcttagactgaaatgcatgttaaattatcctgtgtgctag
GAATGGAAATTAAGTCCAATGAAAGATGCTGTTCTTTTGATGGAGATGCAGACAGAATTG
TTTATTACTACCATGATGCAGATGGCCACTTTCATCTCATAGATGGAGACAAGATAGCAA
CGTTAATTAGCAGTTTCCTTAAAGAGCTCCTGGTGGAG
gtatggtggggggattggctaccctctaaaacaagacttagtagtgaaatagttccatat
tttacaatcatttgtcagaagggcacaatttatgacaaattctttacattagtgggcaga
aaattaaaaaaagagcagtggtaatacccagtcatttgaacatttgaggcattggctttg

Exon  8 +      16616      16750   0     Single    135    42    Marginal
tccaaatatagtaaggaaaagtagggctttatagccaaggagcagggtgtgtggggggtg
gtcagtggatgaaaaattactgagaggaaacatgagggtaagtgggtggtattttggcta
aactgatctaacaggacttttgctgaaggtaggccagggcggtcacatattacctggggg
ATGGTAGAGAATGAGAACTCAGATCAGATGTCAAGAGTGGTCATGTATCAGGATGAGGGA
TTCTCGCTAAGCTCACTTAGCATGACTCTTATTAAAATCGGGCTATTGGAAGACATGCCT
AAGGACAAGGCCTAG
tcaggcccacctaaacctaactaaagtttggtcaaggagagaatttttgtcattagccat
cttttatcttagcaaattgtattggaatgtgtccgcttggctatattaaagggtgagcgt
ttatctttgctatctcttagcaaattagcctgtgattgaacatcagtttggcttaatact

Exon  9 +      18357      18455   0   Internal     99    84        Good
ccagagtgtgttcatgcttccattgtatacgtaccattttgtattttaatgcttaatcgt
cttcctcactggactcggccccagtattttgttcccctttgtatctctgggatactaggt
atgcaagaaacatttgacatctgagtaattgctgtatttctttaaatgcatgtgttatag
GTACCTGTCTATTGCACTAAGACTGGTGTAAAACATTTGCACCACAAGGCTCAAGAGTTT
GACATTGGAGTTTATTTTGAAGCAAATGGGCATGGCACT
gtaagttctcttaattatagttggccttagctggcacttttctttatgatgagacttcta
tatctgggaggtaataataggtaatattgtactttgttgaaataattggatgtgacaaaa
agatcctttggttatcttatatattgatgtattatgaaactgtgattctcttttacatgg

Exon 10 +      19930      20043   0   Internal    114    96   Excellent
ctatcctctgggttttaatgtgatcttacattaatttcatacattttaaggctgccacta
tttttcccctcagtttctccagattgactaggagggaaaagtgggttagctagaataata
gtacttatgactaggttttggatagtgttttgagactgattttatattcttttgctgcag
GCACTGTTTAGTACAGCTGTTGAAATGAAGATAAAACAATCAGCAGAACAACTGGAAGAT
AAGAAAAGAAAAGCTGCTAAGATGCTTGAAAACATTATTGACTTGTTTAACCAG
gtcagaactgatggggcagtggactcttggttacctttacattattcagaagatggacag
aacagagtgtgggtgcatacaaaattaaagtggagacgtcctggcctggtggcttccttc
taatagtggtatattcagttgagatttataatgaaatggaatgacagaacattttttaat

Exon 11 +      22358      22480   0   Internal    123   100   Excellent
attttgacctgtcacaggaggccaggtgtggaatttttcacttgtgattattttggcact
cagcatgtttcagattcaggttgttcaacctgtactgtgattggttttctaagaaaaaac
atccatttccaagatttgcttgtgttaagtggtttcttccatttgtttccccatttgcag
GCAGCTGGTGATGCTATTTCTGACATGCTGGTGATTGAAGCAATCTTGGCTCTGAAGGGC
TTGACTGTACAACAGTGGGATGCTCTCTATACAGATCTTCCAAACAGACAACTTAAAGTT
CAG
gtgtgagagaaactttaaagtaacttttttgaatattagctaagtaaaacctattatccc
aattctcattatatctcactgacatatgtttcctatttcattctgtacatacacatatga
tacatagaaaataaggccttatgggccaagcgcagtagctcgtggctcatgcctttaatc

Exon 12 +      23939      24112   0   Internal    174    98   Excellent
agactgaagaaaaagagaaaagttgcacaaatgttgaaattaattaccctgaccttggag
aaagaagttttaatgtaattttatatttagtctggcacttttcgtagaatgtatgtttaa
caggttaagcttctgaaaggaagtgtaatagagtaacaaatatgaaatgcttgcacttag
GTTGCAGACAGGAGAGTTATTAGCACTACCGATGCTGAAAGACAAGCAGTTACACCCCCA
GGATTACAGGAGGCAATCAATGACCTGGTGAAGAAGTACAAGCTTTCTCGAGCTTTTGTC
CGGCCCTCTGGTACAGAAGATGTCGTCCGAGTATATGCAGAAGCAGACTCACAA
gtaagctgggatagttctattgaaaaagagcctaatattaggtgatgggcaggcaaacta
ttttaatggtttttagaatctcactatgatgattaaggctttattttgttgagcctttta
ggttcacattaagactacaaaattattttcaccagcagtaattatacaatttaacaaaat

--------------------------------------------------------------------------------