--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6103 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        326        476   1   Internal    151   100   Excellent
ctgacatgcattttttccgctaattcttatcatcgctctatgcaacataatattcccgac
cccacttcacaggaggaaactgagattacataacctgcccgggggtaagggtggtggtgc
agcttggattccaaatcccgcaggcagcttgcctcccagtccccgatttcctggccccag
GGTCCGCTCTAACCGGTCTCTGTTGCGGCTCAGTGGAAGACCTGGAGCGGAACAACGGCT
CCCTGGACCGGCCCTACTACATGTCCAAGAGCCTTCTAAAGATTCTGGGCAAGAAGAACG
AGGCGCCCCCGGACAACAAGAAGAGGAAGAA
gtgacagctccggccctgatccaggactgcaccccacccccaccgtccagccatccaacc
tcacttcgccttacaggtctccattttgtggtaaaaaaaggttttaggccaggcgccgtg
gctcacgcctgtaatccaacactttgagaggctgaggcgggcggatcacctgagtcagga

Exon  2 +       1331       1489   0    Initial    159    45    Marginal
ctgcgtgatcacgtgggaggagatgagctacttgaagaccaattagagtccgggaagcgc
ggcggggcctccagaccggggcgggcttaagggtgacatctgcgctttaaagggtccggg
tcagctgactcccgactctgtggagtctagctgccagggtcgcggcagctgcggggagag
ATGACTGGGGAGCGACCCAGCACGGCGCTCCCGGACAGACGCTGGGGGCCGCGGATTCTG
GGCTTCTGGGGAGGCTGTAGGGTTTGGGTGTTTGCCGCGATCTTCCTGCTGCTGTCTCTG
GCAGCCTCCTGGTCCAAGGCTGAGAACGACTTCGGTCTG
gtgagtcaccctttgcatagccccatccccgacccgcgcaggtgatcgacacctagtgtc
ccccggaacgcgggcggctgagccgactttccgcgacaggacccttttctttctcccaga
ccccgtttcctcctaccgctcccagcccctctccctctccgggtccccgtccttctcctc

Exon  3 +       1916       2108   0   Internal    193    99   Excellent
ctcccctgctccgagcctccagcttcgctccaaactccccttcgtgttcctctttcttgt
tctgggaccccatcccctactcgggatccccattagatcctccctctcccatcggaacgt
gggttcctaaaacccccaagacaagtttgtctttgttgacccttcctcctcccatgacag
GTGCAGCCGCTGGTGACCATGGAGCAACTGCTGTGGGTGAGCGGGAGACAGATCGGCTCA
GTGGACACCTTCCGCATCCCGCTCATCACAGCCACTCCGCGGGGCACTCTTCTCGCCTTT
GCTGAGGCGAGGAAAATGTCCTCATCCGATGAGGGGGCCAAGTTCATCGCCCTGCGGAGG
TCCATGGACCAGG
gtataaagatgtctgggtgaaagagccggtgctaggttggatgggtgggcagcccaatga
gcccaagggccctgaggataggggaacttagagggttggttgcctgagtccctgaggggt
agagggaacccgagaagggcaagtgtctaggacagtgatctggaaattgggatcaccaag

Exon  4 +       2657       2886   1   Internal    230    71        Good
taaatgcaatggagaaaaataaaacaggacaagaggtatagatagtgcaagtgttggatt
gcaccctgggaccatcggaaggcctgaggtccctagcagaaggtgggaaattaacgggaa
gtggtagaaagggtacctgcagagtgctcactctgggtttcttcctccaatttttttcag
GCAGCACATGGTCTCCTACAGCGTTCATTGTCAATGATGGGGATGTCCCCGATGGGCTGA
ACCTTGGGGCAGTAGTGAGCGATGTTGAGACAGGAGTAGTATTTCTTTTCTACTCCCTTT
GTGCTCACAAGGCCGGCTGCCAGGTGGCCTCTACCATGTTGGTATGGAGCAAGGATGATG
GTGTTTCCTGGAGCACACCCCGGAATCTCTCCCTGGATATTGGCACTGAA
gtgtttgcccctggaccgggctctggtattcaggtctctgtcctaggagataggtggagg
gggctgccttgtggagagtctgagggatacccccaaatggactcctttccaaggggaaga
ttctctgaagtcagattttctggcttgggtgggattccttgaaagacagggcatcctggt

Exon  5 +       3486       3668   0   Internal    183    99   Excellent
gagagcttcttaattcaaacagggtgtgtatttatgggatctgactggaaccctcagtga
gcaagggctgaactcaaggggaccatacatgtgattgcatttgggaagtggtgggttctc
tgtccctgcctctgagcccctagagtctccttctgtgacacccagttccctttcccacag
AAACAGCGGGAGCCACGGAAGGGCCGCCTCATCGTGTGTGGCCATGGGACGCTGGAGCGG
GACGGAGTCTTCTGTCTCCTCAGCGATGATCATGGTGCCTCCTGGCGCTACGGAAGTGGG
GTCAGCGGCATCCCCTACGGTCAGCCCAAGCAGGAAAATGATTTCAATCCTGATGAATGC
CAG
gtcaggagtccatgagatgttccctacccatttgaccctccctgccctccagaacatcat
ttcacgcacagacccagggtctgactgctccactcagtgccacacacccttgctcccctc
ggggacagggcattttccctgttccctccctgaggtcctgtcctctcccctcagccctat

Exon  6 +       3843       4080   0   Internal    238    98   Excellent
tgccaggtcaggagtccatgagatgttccctacccatttgaccctccctgccctccagaa
catcatttcacgcacagacccagggtctgactgctccactcagtgccacacacccttgct
cccctcggggacagggcattttccctgttccctccctgaggtcctgtcctctcccctcag
CCCTATGAGCTCCCAGATGGCTCAGTCGTCATCAATGCCCGAAACCAGAACAACTACCAC
TGCCACTGCCGAATTGTCCTCCGCAGCTATGATGCCTGTGATACACTAAGGCCCCGTGAT
GTGACCTTCGACCCTGAGCTCGTGGACCCTGTGGTAGCTGCAGGAGCTGTAGTCACCAGC
TCCGGCATTGTCTTCTTCTCCAACCCAGCACATCCAGAGTTCCGTGAGTGCCTCATGG
gtggggtcagcagggagagccctgtgtctagacaaggcctgggcagagaccctctctccc
tgactctcctgctctccccaggagtgaacctgaccctgcgatggagcttcagcaatggta
cctcatggcggaaagagacagtccagctatggccaggccccagtggctattcatccctgg

Exon  7 +       3843       4388   0   Terminal    546    90   Excellent
tgccaggtcaggagtccatgagatgttccctacccatttgaccctccctgccctccagaa
catcatttcacgcacagacccagggtctgactgctccactcagtgccacacacccttgct
cccctcggggacagggcattttccctgttccctccctgaggtcctgtcctctcccctcag
CCCTATGAGCTCCCAGATGGCTCAGTCGTCATCAATGCCCGAAACCAGAACAACTACCAC
TGCCACTGCCGAATTGTCCTCCGCAGCTATGATGCCTGTGATACACTAAGGCCCCGTGAT
GTGACCTTCGACCCTGAGCTCGTGGACCCTGTGGTAGCTGCAGGAGCTGTAGTCACCAGC
TCCGGCATTGTCTTCTTCTCCAACCCAGCACATCCAGAGTTCCGTGAGTGCCTCATGGGT
GGGGTCAGCAGGGAGAGCCCTGTGTCTAGACAAGGCCTGGGCAGAGACCCTCTCTCCCTG
ACTCTCCTGCTCTCCCCAGGAGTGAACCTGACCCTGCGATGGAGCTTCAGCAATGGTACC
TCATGGCGGAAAGAGACAGTCCAGCTATGGCCAGGCCCCAGTGGCTATTCATCCCTGGCA
ACCCTGGAGGGCAGCATGGATGGAGAGGAGCAGGCCCCCCAGCTCTACGTCCTGTATGAG
AAAGGCCGGAACCACTACACAGAGAGCATCTCCGTGGCCAAAATCAGTGTCTATGGGACA
CTCTGA
gctgtgccactgccacaggggtattctgccttcaggactctgccttcaggaacacgggtc
tgtagagggtctgctggagacgcctgaaagacagttccatcttcctttagactccagcct
tggcaaaatcaccttccctttaccagggaaatcacttcctttaggactgaaagctaggcg

--------------------------------------------------------------------------------