--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (142539 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (28 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      11745      11859   2   Internal    115    63    Marginal
aggcaattggtaaataatgtttaccaattttcttaatgacatgcctgcatttcctttaaa
ttataagagaacgtggcagaatggacatgttgggaaagtaataaagtttttggagcagta
tcctattgcaacagtgatagtgtataaaagtaatttaaaattagtgtattagtttcttag
GGGAGCCATGACAAAGTACCAGAAGCTGGTGGCTTTAAACATGTATTTTCTCACTTTCTG
GAAGCTAGATGTTCAAAATCAAGGTGTCAGCAGGGCCGTGTTCCCGCTGAAACTG
gtagaagaatccttccttttctcttcctaacttctgttggtttgctggaccttggagttc
cttagcttgcagcggtatagctccaagtgtggcctgtgtctacatggcattctccttttg
tgtctctatcactacatggccatcttcttatggggattccagtcatactggattagggca

Exon  2 +      13836      13989   2   Terminal    154    87        Good
tgtaggcacaaaacaggttctaagtgcttactgaattgaagaaaattactcataaatata
ttacaaggcactatttaggagtaagcataagttgtttattgccacatactctccatgtaa
atatgctgaaagcacattaaaaaaatgataattcagttattttattttgcatttttacag
GTATGAATGTATGCCAGTATATTTTGAAAATGCATTCAATTGCAGATCTCATCCACAGAA
GGCAAAGAAGTACATGGCCTTTTCTTTAGTGAAATGGCAGTTTAATGGTAAATTGTCTCT
CACTGATAACATCTCAGAAGACACTCAAATTTAA
ttcttgaaaagtagtgtttgctatttatatactgtatgtttttggaaaggcattccattt
atcttttaacgcctttcatctatccaattttgttggttttatcagttaactcttaattca
gatccacaaagtagcccccaacaaatagtaataagtagtaatagtagtagtggtaactac

Exon  3 +      25524      25637   0   Internal    114    93   Excellent
cattctgattgtagtttctcccatggacatttgcatttcatatttgactcatgtgactgt
ttcctggttaaagtttatttttcatttgttttagtccatgtagttctactccattttatt
tttcacattggccagtgtaaacttttaagtttacagttgctttgttatcttttcttacag
GGTTACGACTCACTGATTAAAAAGAGGGACTTTTTCAAATACTTTGCACTTTTGATTGTG
TATTATGGATACCAAGGAAGAGAAGAAGGAACGGAAACAAAGTTATTTTGCTCG
gtaagcattcattttacaaaattgttatcagtactttaaagaaatatttgaggggacttt
gtcctcaagtattacttcgcattttgtgttttgtgcttgttcataaatagagcaggtaac
caggagaagtaaactatactttgcttcatccattttattcatattagaggagtgtaacat

Exon  4 +      37024      37121   0   Internal     98    80        Good
ttgcttgcatctcagagagaccttatgtgcctgtgcctattaagcccagacggtagattg
gtaaacaaaacaaatatggtccttgcccttatggagaatacttttcacaaatacgttgtc
ttagttcattttgtgttgctttaacacaatgtcacagactgggtaatttacaatgaacag
AAATTTATTTGGCTCACAGTTCTGGAGTCTGGGAAGTCCAAGAGCATGGTGCCAGCATCT
GACAAGGGCCTGCATGCTGTATCACCCCATGGTGGAAG
gtgggagggcaagaaagggtgagagtgggctgggcgcggtgacccatgcctgtaatccca
gcactttgggagtctcaggcgggcggatcacctgaggtcaggagtttgagatcagcctga
ccaacatggagaagccctgtctctactaaaaatacaaaattagctgggcgtagtggcgca

Exon  5 +      53487      53590   0    Initial    104    92   Excellent
tggtacctgagaatgttaccttttatggccaaagagatcttgcagatgtgattaagggcc
ttgatatagggacattaacttggattgtctgaatgggtcctatatgcaatcctaagtgtc
catataagagggaggtttgactgcagagaaagcagtgtgccatgcagctggctttgaaaa
ATGGAGGAAGGGGCTACCAGTAATATAGCTCTAGAAGCTGGAAAAAGCAAGAAAAGAACC
TCTAATGGGGAGGATGGCCCTGTGGACGCCTTGATTTCAGCCTG
gtgagtctgattttagacttctgacctccagaactgtaagagaataaatgtgtgttaagt
taccaagtgtgtggtaatttggtacagcagccatagggaattaatacatccagtcaattt
aactatgttaaataagctacgtgcataatatcaatgtaaagcaaaagagaataaacaact

Exon  6 +      55283      55469   0    Initial    187    65    Marginal
caaattagtaacttttgtttattaagctcttcctggaaaccaggcacaggttgtgtttaa
tagtaaagtaagctttctctgtaccatttgctttaatcaccattaaaaacccattggagg
ctattatttttatgtcaaggacaacaaacctgaggcttagatttggtaactcgccaaagg
ATGTGCATCCAAAGTACAAGACGATTCAAACACAAACGTTTCTGCCCAAAGACTGAGCTC
GTTCCATTGTCAGAGGTGGCAGAAGTCAGAATTAGACGACCAGGAAAAAACAGCCTAGGC
CCTGAAGGTCAGAACAATGCAATGACAAGGCTGCAGCCAGAACAGCCAAGAAAAGAACCA
AGAGAAG
gtccctggagggaggcagaccagctctatctgatttaaaaaaaaagtgatgtgggattgc
agtccagcaatttactaagctagctggactcaggagaaagaatgaaccactaaacaagag
gtagcaaaatgttgccatagctgcagatatttaattttgttgttgtttgttaaccttata

Exon  7 +      57840      58368   2   Terminal    529    63    Marginal
accacattgagcaatgccatacaaggtatttacgtctttttcaaaagtgtgcatttttca
aaaacacatggatcccaaattttaaaattaagaacagagtcatatataactgtgaattta
atactaattaaagcagtctgtagttcagtacattttaaattatgtgtggctaatatgtag
AAAGCTGAAACTGGATCCCTTCCTTACACCTTATACAAAAATTAATTCAAGGTGGATTAA
AGACTTAAATGTCAGACCTAAAACCATAAAAACCCTAGAAGAAAACCTAGGCAATGCCAT
TCAGGACAGAGGCATGGGCAAGGACTTCATGTCTAAAACACCAAAAGCAATGGCAACAAA
AGCCAAAATTGACAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAGAAAC
TATCATCAGAGTGAACAGGAAACCTACAGAATGGGAGAAAAATTTTGCAATCTACCCATC
TGACAAAGGGCTAATATCCAGAATCTACAAAGAACTCAAACAAATTTACAAGAAAAAAAC
AACCCCATCAAAAAGTGGGCAAAGGAATGAACAGACACTTCTCAAAAGAAGACATTTATG
CAGCCAACAGACACATGAAAAAATGCTCATCATCACTGGTCATCAGAGAAATGCAAATCA
AAATCACAATGAGATACCATCTTACGCCAGTTATAATGGCGATCATTAA
aaagtcaggaaacaaccaatgctggagaggatgtggagaaataggaatgcttttacactg
ttggtgggagtgtaaattagttcaaccattgtggaagtcagtgtggcaattcctcaagga
tctagaactagaaataccatttgacccagccatcccattactgggtatataccccaagga

Exon  8 +      58738      58852   0    Initial    115    49    Marginal
atgctgctatgaagacacatgcacatgtatgtttattgcggcactattcacaataacaaa
gacttggaaccaacccaaatgtccatcaatgatagactggattaagaaaatatggcacgt
atacaccatggaataccatgcagccataaaaaaggatgagttcatatcctttacagggac
ATGAATGAAGCTGGAAACCATCATTCTCAGCAAACTATCACAAGGACAGAAAACCAAACA
CCGAATGTTCTCACTCATAGGTGGGAATTGAACGATGAGAACACTTGGATACAGG
gtagggaacatcacacactggagcctgtcggggggtggtggttgggggatggatagcatt
aggagaaatacctaatgtaaatgacgagttgatgggtgcagcaaaccaacatggcacatg
tatacttatgtaacaaacctgcatgttgtgcacaagtaccctaggacttaaagtataata

Exon  9 +      65253      65473   2   Internal    221   100   Excellent
taagaatttgtaagttattggaaaagaaaaaagaacaatacatgtaatgaaccatattat
aaggaaagtgttttctgtatcagttcattagttttcaaagtccagcagcgtgaaattaat
atgatttctaccagcaaatcatctctccaatgttttttcttttttttccctctttcctag
ACTGAAAAAGAAAAAACAAGCCAAACAAAATGCAGAGACAGCCTCAGCTGTAGCTACAAG
GACTCATACTGGGAAGGAAGATAATAATACAGTAGTTTTAGAGCCAGACAAGTGCAACAT
TGCTGTGGAAGAGGAATATATGACTGATGAGAAAAAAAAGAGAAAAAGTAATCAGTTAAA
GGAGATCAGGCGTACAGAACTAAAGAGATATTATAGTATTG
gtgagtattcatggcgttactgcagtattttcatttaaaaaatctataagaatttttaaa
agactatcatttgtgattgatcataataatggtaacagtttatggagcagctgctatgtg
cccctggcccttgctttacatacataatcttgtgtaaggggatcacactaaaataatgtc

Exon 10 +      83802      83898   0   Internal     97    74        Good
tttagtgtccatctgtgatgtatgtttaaaacagatggacactaacatcccattcagttt
ttcttgatgtaaacctgtttacccttttggtgtatatttctggcttgttattcctaattg
ctggaatctaattgctctggaatctcagagcttacctatcatgctttatttaccctctag
CTCCCCATTGCCATAGATAATACTGTGATGAACATCCTTCAGCAGGTCCCTTATGATGTA
CATAAAGTATATACCTGTTGGGAGAGGATGCTTATCT
gtgagttaaattgctaggtcatatgagctatatatacttaattctctggaatgactgaac
agtttacattccttgtagtggttcacatttctgtcaacattggaattatacagctttctg
attttaccaggctaataggtataaaatgatacattgttttcatttgcatttttctgatca

Exon 11 +      85122      85201   1   Internal     80    72        Good
catttattcaggacgaatagtgtgcttttatgagtatgatctatttgtgccctgagtcca
ttttcctattagtgtctttttgtcagttgatttgaaagtgggtttctatatatggtagtt
ttaccctggcttcagtccctgaaaatgaaattattcatttacatacaatttattcttcag
ATGACAATCAAAACAAAACACATGATAAAAAAGAGAAGAAGATGGTGGTTCAGAAGCCCC
ATGGGACTATGGAATACACT
gtgagtataaccaaggtggtataaatgtttgttaatagcactacatttatataatggttt
tccctgacacatcctgccccttggctgcattcctcttgtgtacccattaaacaatcaagc
ttcttaagaccagttttaggtcatttctttttcctccatattttctccctggtcaatctc

Exon 12 +      88496      88603   0   Internal    108    97   Excellent
taagactttgctgtaaaatgattttattaagaattgacaatgtattcattctttcttata
gtctatcttgatggaactattagtttgttatttattcatattgcagataaattaatagta
tctatcaaaagtaattttttttgctttatttattgactcttacctgtttgattattctag
GCTGGAAACCAGGACACCCTAAACTCCATAGCACTGAAATTTAACATCACTCCCAATAAA
TTGGTGGAACTGAATAAACTTTTCACACATACTATTGTTCCAGGCCAG
gtaattatactcttactggatataactctagaaattctgcatttatcttttattgccgtt
ttcagtgcctcactattgtttgtcacaggattatgataaatgataatgtgctttggttca
atattttctctcctttatttttatttatttattttttgagacagggtcttgctctgttgc

Exon 13 +      95392      95576   0   Internal    185   100   Excellent
cctagcattgcatttcttcagcctgtttttctggtcctcacaaaggggatgtaattgtca
cataggatactgtggttcacaaagtccatggagtggccatctgagttaattaaagctctg
tggtagttgctgaaagcatttctgcctgaagtgattctgtcctgttgctttctcctgcag
GGTGTGGTTGGCGGTGTTATGATAGTGACTCCTAACAACATCATGTTTGACCCTCATAAA
TCTGATCCTCTGGTTATTGAAAATGGGTGTGAGGAGTATGGTCTCATCTGCCCCATGGAA
GAGGTTGTTTCCATTGCGCTCTACAATGACATTTCTCACATGAAGATCAAAGATGCCTTG
CCATC
gtaagacatttatttgtttaccaggaaaaaaggggtgttgagagagctaaatgtagctta
aaaatgagggcatttgcatgattgagggattgtgtagaggtgattttgaagatggaagac
ttgtgcactgaagaaaatgagaaaaatgagaagaaatgaaaagaataaaatcaatgatgg

Exon 14 +      95674      95735   1   Terminal     62    76        Good
ctcatctgccccatggaagaggttgtttccattgcgctctacaatgacatttctcacatg
aagatcaaagatgccttgccatcgtaagacatttatttgtttaccaggaaaaaaggggtg
ttgagagagctaaatgtagcttaaaaatgagggcatttgcatgattgagggattgtgtag
AGGTGATTTTGAAGATGGAAGACTTGTGCACTGAAGAAAATGAGAAAAATGAGAAGAAAT
GA
aaagaataaaatcaatgatgggaaaagttgaacatataaagattaaaggagaaaaacaaa
gaagccgtcatgtaaaaatagtatttgttgggcttatttttctaaaaagcagtgcacgtt
cttaatgaaattatgaaggaagaaaggcagttctctgaaagaagtttatccaattatcaa

Exon 15 +      99205      99331   2   Internal    127    74        Good
gaaatcatttgaacataaatttaagttgtgatatatttatgtattggtttttggttgagt
ttctgttttgttttttgcctttcctccattttgtttttggttttatttttaacattccat
gtgcacccaccatttctcccccaacagtgacctacctcaggatctttgtcctctgtacag
GCCTGGAGAATGGGAAGACCTGGCTTCAGAAAAGGATATCAACCCATTCAGTAAGTTCAA
ATCTATCAACAAGGAAAAACGACAGCAGAATGGAGAGAAAATTATGACTTCGGATTCCAG
ACCAATA
gtacctttggagaagtccacaggacatacacctacaaagccctcaggcagctctgtgtca
gagaaattaaagaaactggactcctctagggagacatcccatggttctcccacagtgact
aagctcagcaaggaaccttccgacacttcttctgcatttgaatctacagccaaagaaaac

Exon 16 +      99986     100214   0   Internal    229    68    Marginal
gtagaaaacacactgaacatacatgaagatttagataaagttaaactcattgaatattac
ctgactaagaacaaagaagggccacaggtatctgaaaatttgcagaaaacagaattaagt
gatggaaaaagtattgaaccagggggaatagacattacccttagtagttctctttcccag
GCGGGTGATCCCATAACTGAGGGCAATAAAGAGCCAGATAAGACCTGGGTGAAAAAGGGA
GAGCCCCTCCCGGTAAAACTGAACTCTTCTACAGAAGCAAATGTGATTAAAGAGGCTCTA
GACTCCTCTTTGGAATCTACTCTGGACAACAGCTGTCAAGGTGCACAAATGGATAATAAA
TCTGAAGTTCAGTTGTGGCTGTTAAAGAGAATTCAGGTACCCATTGAAG
gtaagctgtttttctttaatgcctttatattctgttgcataattgcctttctacaatttg
cacatgtaatacccacattagtacatttatttgaaaacagtattttctcaatagagtgta
tctttgctgatagcattaacaattggggagaaaatttacaagatatggtatctattttgg

Exon 17 +     100916     101043   0    Initial    128    87        Good
agtcctgatacgatgttgtaggatgtttctgcaatgttttgactaagagaggattgtgca
ctattttttttaagttgaaaaattctgctattaccaatattgtcaatattgaggaacagt
tttttcgtgtgtgattcagatatacttccttcaaaagaagaaaaaagcaagaccccaccc
ATGTTCCTGTGCATCAAAGTGGGAAAACCAATGAGAAAATCCTTTGCCACTCACACTGCA
GCCATGGTCCAGCAGTACGGCAAACGGAGAAAGCAGCCAGAGTACTGGTTTGCTGTTCCT
CGGGAGAG
gtgagtatgggctacaatggaaagtctgtgggtctgttaggtttggatggcgttttgata
ttctttatcttaaaatacttaattttattcttgaataagagctttatctgaattgtagat
tttagaattctagaaggatattatttaaagggactttctgctaaatggtggttttaatat

Exon 18 +     104829     104924   0   Terminal     96    49    Marginal
ttccctagaagaggtgtggagtcttgggctgaaataatgagccccagaaccaggcagatg
tgaatgggaatccccagaagtatgggcctttgaatgagatactttatctccttgtaccat
aatttcttaatttaaaaaatagatcaataaggacaacgtgaagtttaaagttcaatgcag
AGGATACCTTACACATTCATCATCACAGACAAGGAGAAGGCAGAAAAGCTAAAGCAGTCC
TTGACCCCTGGTTTGGCAGTGAAGGAGCTGAAATGA
accagacacactgatttggactgtattaaccgatttcccatttgcaccaagaatactgtg
ctggcagcaagctgtacttttttttttttttcctaaatgggaaatgggttaaaatattta
aaaatttaaaaatgtagatgattgtaagcattaagtaattagatcatatttgaacaaata

Exon 19 +     115436     115468   0    Initial     33    48    Marginal
agtaattctgttcactcatccatcagccctgcttagtgtcctgaggtagtggaagcccag
agaagctcagtggttcatccagaccacagcgtgagtcacagagagtttccaaaaagccat
tgacagacctgccaaggttaaaacgggtgatgactgagatactgctgatgtttacagtgg
ATGATCTTTGAGAAGATCAGCTTCACTAGAGTG
gtgagggaaggaataagattttttttttttttttttttgagacagagtttcactcttgtc
gcccaggctggagtgcagcggtgcgatctcggctcattgcaacctatgcctccggggttc
aagtgattcttctgcctcagcctcccaagtagctgggattacagacccctgtaatgccac

Exon 20 +     116491     116554   0    Initial     64    44    Marginal
caagcatggaatttatggatccagatgaaggagataggggaatggaaaggtcgcaaggtg
gggtggtggaaataatagaggaaattcaccagggagtgggacccttaaaagtacagagag
gagggttaaaacaggtcaaagagcagttactccttttgaagaaaaagagtgctaagaggg
ATGGCAGAGGGAACACATTTTAAGAACAGTACAATAGAGAATCTTCCATTCCGAGAGGAG
GCAG
gtaggagagtggggtgagcttgaaaaaatagaggctaaatatgtactgtgtagagtagga
aagaaaaaaagctacaggtgagtacggagctgcaccaggagagggtttttcctagccaag
attagctgcctttgtagtggacccattaagcccaaataagcaaacctagctacattcatc

Exon 21 +     124507     124632   0     Single    126    41    Marginal
ttttctgggaactaatcttgaggaaataattcgaaccatagtgaaaggcctacactgtat
ggatagttactgtaacgtcattcatacaattaaagaaatacaaacaaactaaatatcctg
acagcataggaatacaggctaattatggtttattaacttcatgaaatgtagctgttaaac
ATGACTACAAGGACTAGCAATGTGGTAAAAGTATATAATGTTAAATACAACAGTTATGGC
TTGGCTCTGATGGCAATGAAAAGAAAGCTGTATAAACGATGTACACTTGTGGACAAGAAC
AGATAG
gaatgtagaaaccttaaaaatggtttgatctgttaggatatcagaattgtcggtggtatt
tctgtttttgttttagtcctattaatattattgcaattttatgtaattataaattttaaa
aatcataagttaacgttatcccaacagtagcctcaaattcaaattatcatttagtgatta

Exon 22 +     125597     125730   0   Internal    134    98   Excellent
gtagagataaccttgataatgggaaattttcaaattagtaaaatggatttgccaagcagg
gaaaagatggtttatgtactgaagtccacactagcacctgccaagaaagtggacatggtg
ttaacatctgtcacaaacgtgtttttcagggtggatcatttgtacacattctttgttcag
TGGTCTCCCGATGTCTATGGAAAAGATGCCAAAGAGCAAGGCTTTGTGGTGGTGGAGAAG
GAAGAACTGAACATGATTGACAACTTCTTCAGTGAGCCAACAACCAAGAGCTGGGAGGTG
AGCACTTGGGCAGG
gttagaccgtcgtagttcctaaggtacagtaagcagtctcgcattcagattccatgtaac
aggctggtaagaaactagagtccctgtgcacctatgaaattacagaggaaaataacttta
ttcctccgtttgaaaaaaaacaccaccaccagcaccaccgctatgtacacaggcacacag

Exon 23 +     126381     126498   2   Internal    118    51    Marginal
tagcttaagtgccatacaaaaacaggtggtagactggctttggctgacaagctgatatag
tttggctccacgtccccatgcaaatcatatcataattataatccccaaatgtcaagggag
gcacctggtgggaggtgattggatcatggggacagtttccccgtgctgttctcatgatag
TGAGGGAGTTCTCACAAGATCTGATGGTTTTAAAAGTGGCAGTTTCCGCTACGCTCGCTC
GCTCTCCTGCCGCCTTGTGAAGAAGGTGCTTACCTCTCCTTTGCCTTCTGCCATGATT
gtaagtttcccaaggcctccccagctatgtggaactgtgagccaattaaacctcttttgt
ttgtaaattactcagtttcaggtagcatctttatagcagtgtgaaaacggactaatacac
aagctgtagtttgccagacctcagttcccttcatccagtcaggcaagcatgtatcaagta

Exon 24 +     129423     129511   0    Initial     89    42    Marginal
ggagggacgattaggaaaaaaagtataagaaggaaaagaaaaaaaatgaacaatggggtt
ttatcatagtgttgggaaaccaccgtttcaaaggtgaaagtgtccttttacagtctcaca
gcgatgcctggcaggaagtgtgtttgctctaaatcctaatttgggtgtgttcctgtagaa
ATGTTGAAACTTCTCCTGAGGGAAACAGAAACTCAATCATGCAGGAAACTAGATACTGAG
AAAACAGTTGTAGCTCAGCGTGGCTACAA
gtaactgtggtgtggaagcagagtagagagaaaacttgttcctcattagagagagagcca
cacttctcactgctcacaatgagaggccaaagattacccttggacatccagattttctat
tgtgccagacctgacgaagagccttttgtgaaggtatgttggagtgcgtcccgagggcta

Exon 25 +     129590     129664   0    Initial     75    84        Good
tgttcctgtagaaatgttgaaacttctcctgagggaaacagaaactcaatcatgcaggaa
actagatactgagaaaacagttgtagctcagcgtggctacaagtaactgtggtgtggaag
cagagtagagagaaaacttgttcctcattagagagagagccacacttctcactgctcaca
ATGAGAGGCCAAAGATTACCCTTGGACATCCAGATTTTCTATTGTGCCAGACCTGACGAA
GAGCCTTTTGTGAAG
gtatgttggagtgcgtcccgagggctaataaggtgctggtgaattctcagtgatgtacct
ccgagtttcttttgaaagtcgttctaattagaaaggattgtgctgacatttctaccagca
ggtgttttattcattgcggagagggttatggtgtggttgcctcttctcattggagccaga

Exon 26 +     131176     131331   0   Internal    156   100   Excellent
taattgtgcatttgttctgaaactgaaaaattagccatttccccaaagtcctgttcagtt
gatttcctgctgccgaagcgtcaccttttcaagcacgggtgtccctagagtgatttttta
aattagcagttagaagaaaagccaataagttatttttcttggcttgttttctcatttcag
ATCATCACTGTTGAAGAGGCAAAGCGCAGGAAGAGCACATGCAGCTACTATGAAGACGAG
GACGAAGAGGTGCTGCCTGTCCTACGGCCCCACAGCGCGCTCCTGGAGAATATGCACATC
GAGCAGGTGGGCTCGCCCTGGCCACCAAGGGTGGGG
gttcctaggctttaagaaatatttcccttggccaggtacagtggctcatgcctgtaatcc
tcacactttgggaggccaaggcaggcggatcacttgaggtcaggagtttgagaccagact
ggacaacatggcaaaaccccatctctactaaaaatacaaaaattggccgggcgtgatggc

Exon 27 +     132915     133067   0   Internal    153   100   Excellent
taaacactgtcaaatgatcattttcttggtttagaatagcaaatatttgccagaataagg
aggggcactatgtgagtgtatgatactgagtttgaataacaggcatttgttttgtgccac
atgttcgtgagcaatttgtgggtgaaccttctgtttacatctcttcctttggctttgtag
CTGGCCCGACGCCTTCCTGCAAGGGTGCAAGGGTATCCATGGAGACTGGCCTATAGCACG
TTAGAGCACGGGACCAGCTTAAAGACGCTCTACCGGAAATCGGCATCACTAGACAGTCCT
GTCCTATTGGTCATCAAAGATATGGATAATCAG
gtgaggcctgtccctctcataaagaatattttttaataatttttcaaaattcccaacagt
agagagactagtaccatatacttccatcacccagattccacagttaacaggattttgcct
tctgtgtcttttatctttgttttttctctgctgaaatattttgaagtaaatcccaatcat

Exon 28 +     138869     139004   2   Terminal    136   100   Excellent
cttgtcttttaggaagactggtcatttaaatgaaataaaggaaatgtatcctggttttat
aagcagtttagaattttgcctgtcagtagtataaaggaaagaagatgggggcaagagaga
atagtgtgtcatgtaacatagaagtgtttttacctttttttttttttttaaccttttcag
GGGACGATTTGGTTTATGGCTAGATGCTGATTTATACCACGGACGAAGCAACTCTTGCAG
CACTTTCAATAATGATATTCTTTCCAAAAAGGAAGACTTCATAGTTCAGGATCTGGAGGT
GTGGGCATTTGATTGA
aattcagactgccttaaaatataacattaaaaagactgggttcgatcagccctcctaaag
ctggctggaaaaagaagccccagcccagcctgcctcatcccaccccaatgcttcctttct
gccatcatctcagagcatgatcacattgcagaaagattctggaaggtccatgtagagggc

--------------------------------------------------------------------------------