--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (40147 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (17 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5684       5801   2   Internal    118   100   Excellent
aaccagtttacaatactagagcaacagaatgcagcaaacaatcttgttgtgcaagttttc
aaagttttgtcttcataacctttgaaaagattgttgaggagttttgtgtaagttttgtaa
tccagtagtagtctaaatcctcttgtttcagcccacgtctacccattcttatttctgcag
CATATATAGCAGTGACGAGGATGATGAGGACTTTGAGATGTGTGACCATGACTATGATGG
GCTGCTTCCCAAGTCTGGAAAGCGTCACTTGGGGAAAACAAGGTGGACCCGGGAAGAG
gtaactaatcattttatcaagacgcagaaaatagatagagtgtataatttataaaaaaca
aaatttcaactaaactacaggtgctcaagctcattagcaggctccttgagatcttatcct
agcccgcatgtgcagcgtgccctatgccccccacttcattatattatccatttccacact

Exon  2 +       7615       7686   0   Internal     72   100   Excellent
aactctggtctgattctaaataaatctatactcccaagtccgtatattacattaatatct
cctgtattcggatactttagagagactttttattctagattcgttccctcattcacttta
acttgaacagagttatatagtaaataactgatatcctaggattacctttaaatgtcttag
GATGAAAAACTGAAGAAGCTGGTGGAACAGAATGGAACAGATGACTGGAAAGTTATTGCC
AATTATCTCCCG
gtaagttagtaagtttttcttataacgaaaggaaagcttctcccaaagatttctataaaa
tattctaggaggagttattaagatagtgtataatttactcacatttaagaagtgggagaa
atgccctacccataacttatattttatattataatgcatataattaaattattagaattt

Exon  3 +       9572       9664   0   Internal     93    96   Excellent
tatattacttgcatgttctgtagcctgtaagtaatgagggatagatgggctctaaacatg
ctctaaaatgttcttaaatattttcactgcatatggtctatgtgtgattcctattacaac
aaaaaattcacgtgcttatcacatcatatctttatggtggtgcatactttatttgtctag
AATCGAACAGATGTGCAGTGCCAGCACCGATGGCAGAAAGTACTAAACCCTGAGCTCATC
AAGGGTCCTTGGACCAAAGAAGAAGATCAGAGA
gtaagttctttcttcattggtgtgtgactcataattaagaatattcccaaaatgctaata
ttttcctatttgaggaagcaggtaaaatgggcaaacaggaagtagaggactctattccca
tatttccagtgaatgaaagcaaattttggaaattttctaaagatcttgtaacactgaaga

Exon  4 +      12105      12339   2   Internal    235    97   Excellent
ctaactaggcaatagagaaagcctgatctcagagggtggagaagaaggaaacaattaaaa
agagaaaacaactaataggcccaagggaaaggtctctgttagaaacagttttctgtcaat
tcactttaatctgaattgaaatttttgtttgtgaaatttgtgtgatatatttctgtgcag
AACTGATAATGCTATCAAGAACCACTGGAATTCTACAATGCGTCGGAAGGTCGAACAGGA
AGGTTATCTGCAGGAGTCTTCAAAAGCCAGCCAGCCAGCAGTGGCCACAAGCTTCCAGAA
GAACAGTCATTTGATGGGTTTTGCTCAGGCTCCGCCTACAGCTCAACTCCCTGCCACTGG
CCAGCCCACTGTTAACAACGACTATTCCTATTACCACATTTCTGAAGCACAAAAT
gtaagccattcctgtgaatctagtttaatgagagagacggttagtttagctccaggtaat
aatcatactttgcagttgtatacttttcagagaactttcctgagcatgatcatggccagt
cttcacctatgccctttgaagtagatagggtgtaggtatggtgtgttacccctggtttat

Exon  5 +      12528      12588   2   Terminal     61    90   Excellent
ttcctgtgaatctagtttaatgagagagacggttagtttagctccaggtaataatcatac
tttgcagttgtatacttttcagagaactttcctgagcatgatcatggccagtcttcacct
atgccctttgaagtagatagggtgtaggtatggtgtgttacccctggtttatgtctccag
AAACGAGGATGGTAAGCGCTTTGCCCAGGGTGACACAGCTCATAGAGATAGTGCTGACTA
G
aaaacgagctgtccgattctaaattgctgcttcaaatctaatttgaaggcaacctttgaa
tgtaaatttacttaaggtactattgaagaataggggaatggagtcgcatttgtagatgta
atgtttttctcttccaaaacgaaaagggaaggtagtattatgtttaaagaggagagagtt

Exon  6 +      13532      13646   2   Terminal    115    57    Marginal
tttttctctaattaaggaacacttcccaaaatttaaagtgctcatcaacacctcccaagg
atttttcaccatgttcctttagctgtttagccattttaaaggcctggctaaatttcacat
taaaaggttttaaaaatttgtttagtgtattttatcagtaaagtgttttttttctctcag
TCCCAGAACGAAACCTCAGGAAGCCAAGTCCCCTGAAGCATATGTAGCCCTGAATGACGT
GGCCTTTGTTTTGTCTTTTGCATCTAGGTCTCCAGTCATGTTCCATACCCTGTAG
cgttacatgtaaatatagtcaatgtccctcagccagctgccgcagccattcaggtaagat
cattgatcattcactgttcaaagcaccacttttaagaaatgcttatttctttcatctaaa
cacatatttttacctgagcaactaaagtaaaaaggaaagggaacatggagaggagagcag

Exon  7 +      14137      14241   0   Internal    105    99   Excellent
tcccttaagtctgaaataacattcacaaagatttctgcaggagccaaatttggttggtgg
tgttgtcacagtgaggctctttgggctgtgcggcacctcatgaccatattggctacaccc
attgtatttgcagcttccaatcagacctttgtctttatttcccttactttgtaatttcag
AGACACTATAATGATGAAGACCCTGAGAAGGAAAAGCGAATAAAGGAATTAGAATTGCTC
CTAATGTCAACCGAGAATGAGCTAAAAGGACAGCAGGTGCTACCA
gtaagactgtcatcatgtgcttgaatgaggggatagcagctttgcctcagtttacctaag
cgctcttctcttctaaatattacacttagcaaggctccatatatccattcagaatgtctc
aacacaagaagttgcttgtagtaaaatgtagttggtatcagattatatgctgattaaatt

Exon  8 +      15529      15783   0   Internal    255    61    Marginal
ggtcttgcattgataaaaggaaacatcttgacaactgtttcataggcgtaagtttgggat
gatgcaactactcttatctttcctccaacagcatctgataccttgtgcaacttcattgct
aagttccttctccctttcttctgtcctctctttatttctacacccttcccccttccttag
ACACAGAACCACACATGCAGCTACCCCGGGTGGCACAGCACCACCATTGCCGACCACACC
AGACCTCATGGAGACAGTGCACCTGTTTCCTGTTTGGGAGAACACCACTCCACTCCATCT
CTGCCAGCGGATCCTGGCTCCCTACCTGAAGAAAGCGCCTCGCCAGCAAGGTGCATGATC
GTCCACCAGGGCACCATTCTGGATAATGTTAAGAACCTCTTAGAATTTGCAGAAACACTC
CAATTTATAGATTCT
gtaagtagaattgtgaagggaagttaacgattctggaagataaattagaaaacccatttc
ttaaatcattgccattttctatagccaagctgttattagcatatattaatgtaaaggtag
aagtatgattttcatcttcatgaatatgttttttcaaagatctgatttcatagcctaccg

Exon  9 +      18689      18831   0   Internal    143    95   Excellent
cctgggtgctcaattgaaataaaacaataccctagtcaatataacatgcttgttagcatc
tttattatttaatatagtgggtcaggaaaacattcttgttatctaggtgtgatttttaaa
ttggggagaataaagaattaccatctaatctaagtattttttctttctctccatatttag
TTCTTAAACACTTCCAGTAACCATGAAAACTCAGACTTGGAAATGCCTTCTTTAACTTCC
ACCCCCCTCATTGGTCACAAATTGACTGTTACAACACCATTTCATAGAGACCAGACTGTG
AAAACTCAAAAGGAAAATACTGT
gtaagtctttggttcaggaataaaatgatttatcttatttacttatatttaattaatgga
atatagttcccagatgtctgatccacttgtatgtgcataattttactgaccatttatata
taatcatgtctattcccacattgaatatatctgtcctgggcatattacaactacctacag

Exon 10 +      20262      20405   0   Internal    144    63    Marginal
ctctcatctagtagaagatctgcaggatgtgatcaaacaggaatctgatgaatctggaat
tgttgctgagtttcaagaaaatggaccacccttactgaagaaaatcaaacaagaggtaaa
cacgcaaccctttggaagcaacaagctgagaatcctgccccctttattccttgtgtgcag
CTTGATGTGTCTGCCATTGGCACTGTGCAACACCACGACTTTTCGTGCAAGATTTTCATA
CAAGGTGCAGCGAAAAGGTACTGCCAGACTGTAGGCATCATCAACCTTTCCTTTGGGAAG
CCAAGCCATCTCTATCTACTTCAT
gtttggacagaaaacatactagagagtatcaagaaaagggagggaaagaggtttttaatg
tacttttaaacattactgattatataaagttgatatttcatttttagatgtgaagaattg
gaatttaaattaaaataatagtatctttaattaattgtattaaaaaaagggaggctgggc

Exon 11 +      21420      21530   0   Internal    111   100   Excellent
caaatttgccatcagtgtttctttgttgaatccagaagatagagcaaattgagctgatag
tgtaagttagcaacatagttttataaaagtatttgagggactggccagaaatatactcct
gactgtacatgtttcataggaagttctagaaacaacaaagcactttctatatgcttttag
GTGGAATCTCCAACTGATAAATCAGGAAACTTCTTCTGCTCACACCACTGGGAAGGGGAC
AGTCTGAATACCCAACTGTTCACGCAGACCTCGCCTGTGGCAGATGCACCG
gtaagtacgtgtgcaccagcccccaagttgttatgtgacactggtgcctcatgaaatcct
gtgtgtggcatagggctgctgcggtttcagcactccctctttaacacatcttatttctaa
atgttctcctgcacatgatttttaaaaaatgattattaatgtagagtataaagttgagat

Exon 12 +      22998      23105   0   Internal    108    98   Excellent
gttcagacatagttgatttctccttttagctcatagtggggagaatttctggcagatgac
tgcatttttttatgctaatgtgtatcatctcatagtaatctactctccacagtgttagaa
aaatgtggctctcatattatccaacctcatttaaatttcaaattattctcttccctttag
AATATTCTTACAAGCTCCGTTTTAATGGCACCAGCATCAGAAGATGAAGACAATGTTCTC
AAAGCATTTACAGTACCTAAAAACAGGTCCCTGGCGAGCCCCTTGCAG
gtaattactattccaacattggtattttaaaattcattcactgaaaaactgtcatctttg
gtggtggtggtggtggtggtgatggtagtgctggtggtctgtttttcgttttcaacattt
tagacataggggagtaatgcttttatacaattcttgatgtctagaaaaatccaataattc

Exon 13 +      23530      23681   0    Initial    152    73        Good
gaaatgaaacatttcttactgtgactgagactaagatgtattacacgtgtgtcactatct
tcttctgccctcaaatgttttataaaaatatatcaatatagtttactttatgttccaaat
tttttattttttatgctgtatccctaggcaaccaaagctcagagactgttccaattttaa
ATGAAGTCTGAAATTAGTCAGACAGAAAATAATTGCAATGTATTTGACTGTCAGAATAAG
AAAGTCAACTGTCAATGTTGTGAGGCCGATCTGAAGTTGACCATCTGCTGTCAGGTTTTA
ATATCAAAAGAGATTTCCCTTGTAACCCTAAA
gtgggtgtgtgttgatgaaatataaccaattccaaattaatcctgagccaaatgtaaata
agaatgcaaattttgcttccctaaattatttaaagcagtttctgacattaaatagcccaa
tacccagccacctgcagagccctctcctccatccccctgtgccatgcagagggaaacttc

Exon 14 +      23851      23993   1   Internal    143    58    Marginal
gtaaccctaaagtgggtgtgtgttgatgaaatataaccaattccaaattaatcctgagcc
aaatgtaaataagaatgcaaattttgcttccctaaattatttaaagcagtttctgacatt
aaatagcccaatacccagccacctgcagagccctctcctccatccccctgtgccatgcag
AGGGAAACTTCATAACCCTAGAGGAAGTGAAGAGCCTGGATTCAGAAGCTGAAGGTCATA
TTTCTTGCTGTAAGTTAAATGGCACGATCATAGGACAGCAGCCTTTGAGTCTGCCCATTA
CCTTAAAGGGATTTCCCATTCTT
gtgatagtttctccttccaaattgtgagaatctgaaaacttgcccggtaagtatttgtga
tgcttagtttttcagggttttttgttgatgttgctttgttttttgaaacagggtcttacc
cggtggcccaggctggagtgtagtggggtgatctcggctcactgcaacctccgcctccca

Exon 15 +      37645      37757   0   Internal    113    90   Excellent
tctgatcatccatatcccttaagaacaccggatttctgggggccagggaggtaagattct
atctgacaaagccttcctggtgtcaaccacttgccatctgttggtcagtgctggccctgc
tgggtctatagaatgagcttctttgtctgacgctcctgttgccatccctttctccatcag
CCTTGTAGCAGTACCTGGGAACCTGCATCCTGTGGAAAGATGGAGGAGCAGATGACATCT
TCCAGTCAAGCTCGTAAATACGTGAATGCATTCTCAGCCCGGACGCTGGTCAT
gtgagacatttccagaaaagcattatggttttcagaacacttcaagttgacttgggatat
atcattcctcaacatgaaacttttcatgaatgggagaagaacctatttttgttgtggtac
aacagttgagagcagcaccaagtgcatttagttgaatgaagtcttcttggatttcaccca

Exon 16 +      38422      38501   0    Initial     80    53    Marginal
gtaaatgctcatttatggttaatgacattgaaggtacatttattgtaccaaaccatttta
tgagttttctgttagcttgctttaaaaattattactgtaagaaatagttttataaaaaat
tatatttttattcagtaatttaattttgtaaatgccaaatgaaaaacgttttttgctgct
ATGGTCTTAGCCTGTAGACATGCTGCTAGTATCAGAGGGGCAGTAGAGCTTGGACAGAAA
GAAAAGAAACTTGGTGTTAG
gtaattgactatgcactagtatttcagactttttaattttatatatatatacattttttt
tccttctgcaatacatttgaaaacttgtttgggagactctgcattttttattgtggtttt
tttgttattgttggtttatacaagcatgcgttgcacttcttttttgggagatgtgtgttg

Exon 17 +      39448      39527   1   Internal     80    57    Marginal
acagggtgcaggcctgaaggcacctggaaggccgcctggagggggacagtcaggaaagca
ggagcccttgagaggagcactagcctttgatgagaccactgccatcgaaggagacctcac
agggagggagccaagggtaaaccctaactttgtttccccatttctcctatctctgcctag
GGGTCCTCACTGGCAGAACCAACCAGAAGCTGGAGGACAAGGGAGCTCCCATATGGGAGC
CGGCCTGTGAGCCTTCAAGG
gtatgcggagtcgtttgttcaaaatagccccatttcacagatgaatctctactggctcca
tcttcagcttagtgttctcttcactatgctgtaatatcccttttaacataaattccttta
aatttcctttactcactctgttccaattctgaattctcatgggcatgatacacttggtgt

--------------------------------------------------------------------------------