--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (62870 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (22 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4638       4742   0     Single    105    73        Good
gtgtaattgtgtcttagtttgtggttgtgcttacctttgaaatacagttttaacttcctt
ataaaagcacatgtgttctagaaaattacctagtaaaaagaatttggtgaaacaaatcat
tttctggggcaaattgcattaaaatgctaaggaaatgttgtggcaggaagaaaatcagag
ATGCCTTTGATTGCAGCCAAAGAAGTAAAAGCAGCAGCTCAGGCCTACCTCAAGGTGGTA
ACCAAGGTTGATATGGGCATCTTCATTCAATCTGTCTGCTCCTAG
ttaactgctgtccaatattaggaaaaactactactcaacaggttttagggaaacactcaa
cccaaacagaaggcttctattcctgattttcttccaaggaaactgaactatctttgcaca
ttaagtacctgactctctgtgctttgaaagttgaagtcttcctgggtaggaagagtgtct

Exon  2 +       5768       5881   0     Single    114    62    Marginal
tgtcaagaacccttagtagccacttaataaatgtataacgatggcccagagcttatgaga
accacacgtttttttaggagagatcagtgtgagttattttttacctttctataggtgaag
catgacctgtgataaagtattgataacatgtgactgctcttttgactaccataaaagata
ATGCCTGAGAACCGGAAAGGAAAGTACTATTGTATAATGCCCAAATACGTATTTGGCAAT
ATCATGAAAGTTACTATCTGCATGAACTTGTGGTTCCCAAAAGATAGTTATTAA
tggttttgccctcttggacattgcctttgctttgaaagagaatttactagagaatgattt
aactaagacaaaggggagtaagaaaaatgtaagatatacatgccttcatgtgatcttagc
tgttgaaaagcaagttttttcctaaattagtgtaaaagtttttagaaggagtcataattt

Exon  3 +       7257       7384   0    Initial    128    73        Good
tttctggctgtttttttattttttattttttttaacatttcgcctttacttcagttcttt
acagtccaccaaagccaactatgtgtcctagtttaaaaatcatctgcaagtgattgaaga
acttttttaaggttcaaggcgtgagcaccttttatattgtaagagaagcgacagggagtt
ATGGAAGCTTCTCATGGGATTAAGGACCTAGTGCAGGACGAGTTCTTTTTTCAGAAGCTG
GGATTGAAAGAGGAGAGGGATGGTAAAGGTATGAAGAAGTTTCTGGGGCACAGAAGAAGG
CACATCAT
gtaacggattatcttctcttgttaacatccagttgatgcaatagctgaatgcatctttaa
ttcactcctctgtcaaggtaaagacaaagcaagatccatgtaaagaaggtccttttggct
ttgtaactgctattccttatgcagaaaaaaagcagtagtccaagaggcaaaatgcttaaa

Exon  4 +       8619       8701   0    Initial     83    42    Marginal
acttttagttgggcccaacagtttatctttgttttgtgtatgacaaaatagaagcactga
gaattttgaggtacttagccaaggtggtacagaaaataatagcaaagactaaaactcaca
tttgggcccttcaaacaatctttgaggacttgctactgcaagtggagtgagaagacaaag
ATGAAGCAGTCTTGGAGAGTGTCGAGGCTGAAGCAGAGGGTACACCTGCAGGTCATTGCC
ACGGGGAAGGGGCTGGCAGTGAG
gtgaggacaaggcactatggcatcaagggagaggaccattctcgggtctatatgtgtagg
ttggggcaggaggcttggaagaggtgacatgtgagctcgaaagagaaggaatcgatgttt
aatgtttactggggcctggctgaggcactggggcacttgtgcatctcttgaaagaaaggt

Exon  5 +       8980       9129   0   Terminal    150    79        Good
gaaagagaaggaatcgatgtttaatgtttactggggcctggctgaggcactggggcactt
gtgcatctcttgaaagaaaggtgtgtagcatacagggtccttcggtggcactgtcttctc
cgctaacctttgttcatgtgatgcaaaaagcagaaacatttatccttttttttttcttag
ACAAATGCTAGCTCAATTCCTGATACAGAGTCACAGAATCACACAGCTTTAGAGGAAGAA
ACCACCTTAGAGCAAGTCCCATGCCCTAATTCCACCAAAAGTAAACTCAAGGACCAAGAG
ATGCCCCGAGGCACAGCAGATCAGTGCTGA
gtggaaactggaaccagtccctcactttgcctccactgtgggcatgttggtgctgccaat
ggctccagaggattcgctgatatttgattgcagaatgaagacaattagaacatagccata
tcattcattttcatatttgggctttgagatacaaagtactacttctgttcctgtcatttt

Exon  6 +       9709       9816   2   Internal    108    69    Marginal
tagtactatgcacatactaagtactaaaattatcatgttttgggcatatttgatatatga
gggtgctaagtgtagattcgttgtagtgaatgatttatccaagttaattcttggagtcaa
agcagaatttagaaatactgcgagttagaaatacatgctaattctcaaggtaatggacag
GCTGCTACATTCCATTCACTTCTCAAGCAGTGTTAACTATCTGTACCAGAAGCTGAATTT
AAATGCTGTCAGGGCAGAGGAGGAAAATAAAAGACTCAAGGAAGCTGG
gtgtgtgcttgtcaaacagtaagaaattgctcttctcttctaaaaaagaacaatttttct
tctcttccaatttttctttaagtataaggtttttttttttttcaggcttttactttgtca
cttttgttataggcataggaacagagaaatatttttcatccagtaaaacaagtggctatg

Exon  7 +      10693      10851   0     Single    159    48    Marginal
gccctgccgaaattccctatttttaaatctgggattcagcccccagagtgccagtgtgcc
atctctggtctacacagcatggaatctccatatgctaatgtcatatactcagagatttca
ggctagaattgtcaagtcttgttcactatgcaaagttagaagtatgcttggataaagaaa
ATGTACATATACACCATGGAATACTTTGCCGCTATAAAATGGTATGAGATCATGTCCTTT
GCAGGGACATGGATGAAGCTGGAAGCCATCATCCTCAGCAAACTAACACAGGAACAGAAA
ACCAAACACTGCATGTTCTCACTCATAAGCAGGAGTTGA
acaatgagaatacatggacacagggaggggaacaacacacaccagggcctgttgtggggt
aggtgggacgaggggagggaacttacaggacgggtcaataggtgcagcaaacctccatgg
catacgtatacctatgtaacaaacctgcacattctgcacatgaattccggaacttaaagt

Exon  8 +      14313      14347   2   Internal     35    75        Good
aaggaagtagaattcctttgcttggcttagatctatcatagttcatgccctggggtggct
gctgtgcctgagtatgtcgaatcctgagtaaaatcaggttctgtaaactaagcaagaaga
gaagcattgctatggagtagagcagcgaaggcgcctaccatggtcccttcttttttctag
TGCATTGTCCATCGCCCTATTTTCCCAGCGCAACA
gtaagtttttgttctttactttcagattatgaggtgactcatcatatttgggccaccaca
aaaaggatgaatagctgaacaataccattctcaaatgtatttaaccacatcctgctagga
tatgctcagattggactgtgagctgactggtgcttcttgtctaatgctattttggctaat

Exon  9 +      16736      16786   1   Internal     51    62    Marginal
ctaggaaccattgttccaattgtacaatttaagtggatgaggaagggacattaattatcc
aaaaaaggctttattattaataactgatataaatcagtagtataatgccattgcaaaaag
catgagggaagcccacatgctactgtaatataggttactattaagttttggtcaccatag
TTCATCAAGGAGATGGAGAAATGTGTGAGGATTCAGAGATGAATGCCAAAG
gtaattaaaggagtggaaaatgcttcctctgagaaaaggtcatgtaattaaggcaggaga
aggctgagagacacatgcttgattactcatttcatgtgcatagacatttttatgacatag
cttcgttatatccacagaaaactaggcagaagaaatttgcttaagttagaatatgcaagt

Exon 10 +      18069      18111   1   Internal     43    72        Good
tcccttcttctaccattttagggataattgaaatttttaatctataataattttaaattt
acataaattgcaagaataccaaaagaatacccatagatcctatcttagtctgcctgggct
accatacataacatagtaacatagactgggtgtcttaacagaaatttatttttttcacag
TTCTGGAGGCTGGAGAGTCCAAGATCAAATGGTTTGGTTTCTG
gtgagggctgtcttcctggcttttagatggctgcgtttttcctgtgtcgtcatttgctag
ggtgtgtgggggagaggtaaaagacactagccctattgtatcagacccctacccttacga
cctctgtagcctaattacctttccataggtctgtctccagatacaatctcattggaggtt

Exon 11 +      18520      18627   0   Terminal    108    62    Marginal
catactctttacccagatttacctgttgttaacattttaccccatttgttttcctcgcaa
tgcacacaaaatttttgttctacccacttgagaataaattgcatacatcatggcccttta
cctgtaaacccttcagagtatatttcccaagaatgaaactatattcttactgaatcacag
GACAGTAACTACAACTACAATAACTTTAACACAGATAAATATTTTTATCTAATCTACTGT
CCATGGTTTCAGGATGAAACTGCTCCACCTCAGATCATCAGGCATTAG
tctcctaaggagcacgcaacctagatccctcccatgggcagttcacagtagggttcgtgc
ttctgtgagaatctaatgccgccgctgctgatctgacaggaggtggagctcaggcagtaa
tgctcactcacccactgctctcctcctgctgtgtggcccagctcctaacaggccacagac

Exon 12 +      21735      21835   0    Initial    101    92   Excellent
ctctgcaggcagaagactgatttttggaaatatgtatttgggagacagtcacgtcctatt
gaataccttgtgctggtgctgccatcgaaaaatctggttacactctggggaggactgcta
ccactgcagaactgaaccacttcggccgtgagatgagtgtccggcctgagcaggcacacc
ATGAATAGATACACAACAATCAGGCAGCTCGGGGATGGAACCTACGGTTCCGTCCTGCTG
GGAAGAAGCATTGAGTCTGGGGAGCTGATCGCTATTAAAAA
gtaagtttgatccttcactgccatgataattttaactctaccctcaccattacccgtctt
tgtaacagttctaaaggggagtgggtaggatgcctagagaagaaccttagataatgattg
ctgtgggttagatgattattgactctgtaacactcatgttagaggtctgaaaacatttcc

Exon 13 +      30317      30443   0   Internal    127    95   Excellent
taaagttattataaatttcagaggtatactattaaactgtcaataaaatataatttagca
catttctgaggttctaaaattagttgtttctttccaagtatacataggattacttttctt
tttcaacaacagattttctctaatatttgttttgttttgtgtttattccttgccttttag
TCTTTAAAGAAGCTCAACCATGCCAATGTAGTCAAATTAAAAGAAGTTATCAGGGAAAAT
GATCATCTTTATTTTATCTTCGAGTACATGAAGGAAAATCTTTACCAGCTCATTAAAGAG
AGGTACA
gtttggtcatcattatcttattatagaaataaataggcaaagcagatgtgttttctttct
gcttttgtgttttctttctctcctttttttctttttttattttttattttttattttatt
ttattattattatactttaagttttagggtacatgtgcacaatgtgtaggttagttgcat

Exon 14 +      41013      41117   0     Single    105    71        Good
ttgactcttttataataacatttggcttaacacatatggctatacaaaaatattttcttt
atatccctattctataagcttttactgttcttaaattattattattacttttttaacttt
tttgctaaaaactaagacacaaatacacacattagcctaggcctacacagggttaggatc
ATGAGTATCATTGCCTTCCACCTCCACATCTTGTCCCACTGGAAGGTTTTGAGGTGCAAT
AATACGCAGGGAGCTGTCATCTCCCATGATAACAAAGCCTTCTAG
gtacctcctgaaggacctgcctcaggctgttttacagttaactttttttttttttttagt
aagtagaaggagtacaattctaaaataatgattaaaagtatagtatagtgaatactagat
aaggatttttcagcttcattataataagaccaccatcatatatgcagtccatcattaatt

Exon 15 +      43612      43744   1   Internal    133    94   Excellent
agtaatcctatgagaagttcgaaggactctacattatctgtgggatgaatgcataaagcc
tttggtgccatgccagactactttttaaattataactattttgcagagagcaatacaatt
gcaaagaataatacgaagcaaacttgcatttggatttcttctcctctactgtctctatag
GCTTCTTTCATCGAGACTTAAAGCCTGAGAACCTCCTCTGCATGGGACCAGAACTTGTGA
AAATTGCAGACTTTGGTTTGGCCCGAGAAATACGATCAAAACCTCCATATACAGATTATG
TATCTACCAGATG
gtgaataccatttttctcaaaattatttaattgcacttctttaaaaagatatcattatgc
taaggataatattaaagtcacaaatgttaacttttcactaagagaaacagtgcagtctga
aacatatatttatagatatgttggtaatgtacaaggttaaaaatcttgtgttctaaatca

Exon 16 +      44470      44620   2   Internal    151    74        Good
gaagcactacttgtcaacagcagcccacggcagttgccaagttctcacaattccattaca
ccacagtgaactagagagaaaataggaacatatacaccccctcactgagaactgattgtt
atttaatttaatgtctgagtggtggaagcaatagctagcagttaacctttgttcctccag
GTACAGGGCTCCAGAAGTACTCCTGAGGTCTACCAACTACAGCTCCCCCATTGACGTCTG
GGCGGTGGGCTGCATCATGGCAGAAGTTTACACCCTCAGGCCACTCTTCCCTGGAGCCAG
TGAAATTGACACAATATTCAAAATTTGCCAA
gtgctggggacaccaaaaaaggtaatgatacaaaacaaaggccagtgggccaaagccaac
agcttcccatgcttcctccgctcagccctgttcagcactggcatgattgagcacctgccc
attctaggctctttctcttgacctcagtcattctccactgcccacgttctcagatacggt

Exon 17 +      46721      46883   0   Internal    163    94   Excellent
ctctattaatctaaatctatgtctcattccatacagtgccacagtagtgaatgtgggtgg
ttaatgaatgtgggtgggtaatgacatggttgcctttccatttggggcacacatgccaga
atacaaacttatatcacagcaattggctgagcaagattttctatcttttccttctttcag
ACTGACTGGCCTGAAGGCTATCAACTTTCAAGTGCAATGAACTTCCGTTGGCCACAGTGT
GTACCCAATAACTTAAAGACCTTGATTCCCAATGCTAGCAGTGAAGCAGTCCAGCTCCTG
AGAGACATGCTTCAGTGGGATCCCAAGAAACGACCAACAGCTA
gtcaggttttcttccattttcttgttataacgttcatatctaactctgaataatttctat
gaattgcacaggaaatatttagtatttagtattatgggtgagaaatagtacagaatacca
ctaatggtgtactatataaggtatgagaacttaaaatagtttgaaacttactgggtataa

Exon 18 +      47786      47822   2   Terminal     37    59    Marginal
gccacttagacttaaataatgaaatatacccaaaagaggtatggtaacgctgggggctct
tatcactcacaggcatcttgcaagcctccttttgtggtagttacatctggccccttctca
acttgtctcactgacaattacattgctcagaggatcatataagtgaccaattctaatcag
AGAAGATGTTCAGAAGAAGAGTGATGAGGATATTTGA
agaaaagtgccaatgtggtggtagaatttgtgatagctggggagatgatagttggaggaa
taattaaggagtgtagaaaagcaattttctgaaagctcaaggaaaaaagaactacaattt
ggtgccgtaagactttggatggctcaagggctggaaagctctcaggaatgcagttctggt

Exon 19 +      48989      49378   0   Terminal    390    57    Marginal
atattttatggtatcttagataagaaaaatcacaaggggtgttaaaaattcaaggtactg
ttttctaattgggctaagaaacagtagtaaactggtcacaatgaaatatagcccagtaat
caagacagtggtaactttcctggctagacttttctcctaaagccttatttgtcattccag
GCACTTCGATATCCTTACTTCCAAGTTGGACACCCACTAGGCAGCACCACACAAAACCTT
CAGGATTCAGAAAAACCACAGAAAGGCATCCTGGAAAAGGCAGGCCCACCTCCTTATATT
AAGCCAGTCCCACCTGCCCAGCCACCAGCCAAGCCACACACACGAATTTCTTCACGACAG
CATCAAGCCAGCCAGCCCCCTCTGCATCTCACGTACCCCTACAAAGCAGAGGTCTCCAGG
ACAGATCACCCAAGCCATCTCCAGGAGGACAAGCCAAGCCCGTTGCTTTTCCCATCCCTC
CACAACAAGCATCCACAGTCGGTGAGCAGCCCAGATTCACCAGTGAGCTTCGTGTCTGTT
TATTCCTCTTCTGACCCCATTATTGTGTGA
aatattttctttttcagtatacagggtccagttatggtagatttatgtttgcaacagcat
ggaattgtaaagacccttggctttggagtgaaagatctaaattcaagttctggctgtgcc
tgttaaaaccgttgtcactaatggaggcagctatagggtagtggctgggagctggcctct

Exon 20 +      50744      50938   0   Internal    195    76        Good
tgaaggatgagtgagacagaaagattgggaatgtgttttctacagttgccccttcagata
agcaatgttatgccccaggagcctcctttgcatagcagagaaagttcagatggagattac
tcatggatgagttctgttaatgccaagtattgctttcccccaccccgtttgtttacacag
AAAATCACAGCTGGCCTGGAGCACAAAAATGGTGAGATAAAGCCAAAGAGTAGGAGAAGG
TGGGGTCTTATTTCCAGGTCAACAAAGGATTCAGATGATTGGGCTGACTTGGATGACTTG
GATTTCAGTCCATCCCTCAGCAGGATTGACCTGAAAAACAAGAAAAGACAGAGTGATGAC
ACTCTCTGCAGGCAA
gtgtgctgctcacatttgtaaacagactgaatctggaattcatgagattatgggtacata
tccgagaatacatactgtctctcgtgctgacccaagccatgctctcttcattcaggtttg
agagtgttttggacctgaagccctctgagcctgtgggcacaggaaacagtgcccccaccc

Exon 21 +      51054      51231   2   Terminal    178    66    Marginal
catccctcagcaggattgacctgaaaaacaagaaaagacagagtgatgacactctctgca
ggcaagtgtgctgctcacatttgtaaacagactgaatctggaattcatgagattatgggt
acatatccgagaatacatactgtctctcgtgctgacccaagccatgctctcttcattcag
GTTTGAGAGTGTTTTGGACCTGAAGCCCTCTGAGCCTGTGGGCACAGGAAACAGTGCCCC
CACCCAGACGTCATATCAGCGGCGAGACACGCCCACCCTGAGATCTGCAGCCAAGCAGCA
CTATTTGAAGCACTCTCGATACTTGCCTGGTAATATAAATGACTTGGCTTTACTTTGA
ttattaataagaaaccctgtccttggaatcacatattcacaaaggttctgttttagaagg
cagatactagggggcttcccttcagaactgaggggaacatcatagaaatatttgctgaag
cccaagcctcactttttttttgagttggagtctctctctgccacccaggctggagtgcaa

Exon 22 +      55314      55427   0     Single    114    55    Marginal
ctcccaagtagctaggattacaggcatgtgccaccacacccagctaattttttttttttt
ttgtatttttagtagaaacagggtttcaccatgttggccaggctggtctcgaactcctga
cctcaggtgatccacccgcctgggtctcccattgtgctgggattacaagtgtgagccacc
ATGCCCAGCCAGAGTCAACATTTTAGGTTAAAGGGTGTGCTCATCTTCAACTTCACAGAT
ATTGCCAAACTACTTGCTCTCCAGCGGGATATGGGAGTTGCTCTGCATCCTTGA
tgccacttggtactgtcaagactaaaatttgtgctaatctgatgagtgagaaatggtatc
ctattgtggtttaaacttgcatgtcctatttactaatgaggttcatcatcttttcttgtg
tttattgactataagttttttctcttttgtgacttacctgttcaaattctcttcccattt

--------------------------------------------------------------------------------