--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (12009 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        871        955   0    Initial     85    40        Poor
taaactccatcccttagggtggcattagggtagtcttgggcctgaatttaggtgggccag
tggctgtcttagtgacagcctttccgctctcttctgtcatcccctcccaactgctaatgt
ctaactacctaacaattacccattaaatcagtgtgtctggggttaggagcaggcctcaat
ATGTTTAATCATTCTCCAGATAATCCCAATACTGTAAAGTTTGTGAAACACTTGTCAGAT
AATTCAATTATGAAGGCTGTGGAAG
gtgtttcagtaggatctaattggttaatgttatgacttaattaatttgaatcaaaaaaca
aaatgaaaaagctttatatttctaagtcaaataagacataagttggtctaaggttgagat
aaaatttttaaatgtatgattgaattttgaaaatcataaatatttaaatatctaaagttc

Exon  2 +       4822       4967   1   Internal    146    60    Marginal
aagcacacaaggaaagagcacccaggactgtcatatggaagaaagacaggactgcaactc
acccttcacaaaatgaggaccagacacagctgatggtatgagttgatgcaggtgtgtgga
gcctcaacatcctgctcccctcctactacacatggttaaggcctgttgctctgtctccag
GTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCT
TGTTTGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTC
GCCGTGTGGAGCCCCGAACTCCATGG
gtttccagtagaatttcaagccagatgtggctgcagctgagtcagagtctgaaagggtgg
gatcacatgttcactgttgacttctggactattatggaaaatcacaaccacagcaagggt
atgtggagagggggcctcaccttcctgaggttgtcagagcttttcatcttttcatgcatc

Exon  3 +       5312       5671   0   Internal    360    86        Good
catcttttcatgcatcttgaaggaaacagctggaagtctgaggtcttgtgggagcaggga
agagggaaggaatttgcttcctgagatcatttggtccttggggatggtggaaatagggac
ctattcctttggttgcagttaacaaggctggggatttttccagagtcccacaccctgcag
GTCATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACCGAGGGCTACTGGAAGTACGGG
TATGATGGGCAGGACCACCTTGAATTCTGCCCTGACACACTGGATTGGAGAGCAGCAGAA
CCCAGGGCCTGGCCCACCAAGCTGGAGTGGGAAAGGCACAAGATTCGGGCCAGGCAGAAC
AGGGCCTACCTGGAGAGGGACTGCCCTGCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGA
GGTGTTTTGGACCAACAAGGTATGGTGGAAACACACTTCTGCCCCTATACTCTAGTGGCA
GAGTGGAGGAGGTTGCAGGGCACGGAATCCCTGGTTGGAGTTTCAGAGGTGGCTGAGGCT

gtgtgcctctccaaattctgggaagggactttctcaatcctagagtctctaccttataat
tgagatgtatgagacagccacaagtcatgggtttaatttcttttctccatgcatatggct
caaagggaagtgtctatggcccttgctttttatttaaccaataatcttttgtatatttat

Exon  4 +       6749       6941   0   Internal    193    80        Good
tttccttcctccaacctatagaaggaagtgaaagttccagtcttcctggcaagggtaaac
agatcccctctcctcatccttcctctttcctgtcaagtgcctcctttggtgaaggtgaca
catcatgtgacctcttcagtgaccactctacggtgtcgggccttgaactactacccccag
AACATCACCATGAAGTGGCTGAAGGATAAGCAGCCAATGGATGCCAAGGAGTTCGAACCT
AAAGACGTATTGCCCAATGGGGATGGGACCTACCAGGGCTGGATAACCTTGGCTGTACCC
CCTGGGGAAGAGCAGAGATATACGTGCCAGGTGGAGCACCCAGGCCTGGATCAGCCCCTC
ATTGTGATCTGGG
gtatgtgactgatgagagccaggagctgagaaaatctattgggggttgagaggagtgcct
gaggaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgaggg
tggcaatcaaaggctttaacttgctttttctgttttagagccctcaccgtctggcaccct

Exon  5 +       8167       8199   1   Internal     33    89        Good
aggtgaggagaccagttagaaagccaataagcatttccagatgagagataatggttcttg
aaatccaatagtgcccaggtctaaattgagatgggtgaatgaggaaaataaggaagagag
aagaggcaagatggtgcctaggtttgtgatgcctctttcctgggtctcttgtctccacag
GAGGAGCCATGGGGCACTACGTCTTAGCTGAAC
gtgagtgacacgcagcctgcagactcactgtgggaaggagacaaaactagagactcaaag
agggagtgcatttatgagctcttcatgtttcaggagagagttgaacctaaacatagaaat
tgcctgacgaactccttgattttagccttctctgttcatttcctcaaaaagatttcccca

--------------------------------------------------------------------------------