--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (214542 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (44 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       7879       7952   0    Initial     74    42    Marginal
catcaggagaactagagggggagaagtctagaaatctgttgctccccagccagggtaaaa
acacatatcaaagcctgtagaacatacaaccatgaaggactcttgcggtttttcatgggc
acaggccatggaatcttagagatcatgtagtcaacatgttcattttactcgtgaggaaaa
ATGAAGTTAAATGAAGAGGTTAAGCAACTTGTCCAAGATGGCAAAGTCACCAGGTTTCAC
ACCTCTCAGCCCAG
gtgtgtggtgtggttaagagcatggggttggggccgggcacgggggctcacgcctgtaat
cccagcactttgggaagccaaggcaggtggatcacctgaggtcaggagttcaagaccagc
ctggccaacacggcgaaaccttgtctctactaaaaatacaaaaattagcccggtgtggtg

Exon  2 +      10036      10078   2   Terminal     43    86        Good
agctgtggttcctcattccctgcctccttgcctttgctttgcagttacttctgtgtcctg
tgttgcaggatgcagaggcacctttacccaccgtggaagtctcaccctttctgatgactc
ccctcaaaacctactgcctcttgagaagccctcccatctctcttacctctgggctcccag
AGCACCTGATTACCACCTCATCATCATCCTCATCATAGCCTGA
ttcgtaaggctgagggaaccagctgggtaggacagtggggcaggcactggcctttcccac
cgacttgtgagctctttggaagtcagggactctattttatgattgatttgtcaacataac
acccagcacaattctaggaggtactaccattattatcccatttaaaagatggaaaaactg

Exon  3 +      23805      23883   0   Internal     79    50    Marginal
gagaaggtttgtgtgtggagcaagacacaggagaatgagctagtttggggccagaatgaa
tggttggaggaaaatacatttttcctggggaaacgtggcaatgaggaatgctccacaaca
gagggccttgtctgagctgggtcctgtctcaggcgcctaacccagctgttgggcacacag
GAGACTGTGGAGACCCTGAGCGTGGATGGTCCCACACACTGCATGTCTGTCTGCAGCTGC
ACAGGCCTCAGGGAGCCCT
gtgagagtgggcctgttcctgggctgcaggcagagagccaggggctgccccgttgccaga
gagcattgaggagcttctgtgtgtgctgtgtatatgtctcagccttctttggaattatgg
cagagtctgtccctgcctggtcatttttgtgcctttgatcctaagttaagaataagtgaa

Exon  4 +      25392      25543   1   Terminal    152    64    Marginal
caggggggtgacggggagctggagggatggctgtatcaagagagagctcagagttgagga
ttgctcagttttatttattgtctgtgtgttcacccaatgttggaggattggtctgatcta
ggcagttggaagtagttcatttttggtcagggtcttgtcctttggcttccattcctgcag
TTGACCACACATTTGCAACATTAATGGATCAGCCTTTTCCACTGGGCTATCTGGGTCACT
TCAGTTATGTTTCTCAAACGAAACATCAGCACTGCTTCAGCAAGAAGAATAAAAGCATGG
AAAATGCCCTAATGCCCAAAGCCCACAATTGA
atgcatagacaactgtttaaaatgtctgtgtaactacatatgcatatcaatataatatat
ctgtacgcacatgcacacacacacgggggtgggcgtgggagaagcctatcttcccttagt
cttggaaacctaaaacttgcatcttcaaaaaatcagatttagaataaagataaattagga

Exon  5 +      27996      28036   1   Internal     41    95   Excellent
cagacaggtgtttgtggcaactgtgacttagcaacaattgtgtgaatgataaaaaatttg
tgggcaaattgattgtctgcaacaaatggaaattctatggtggtgctttgtgggtggttt
gtaggcagagagtacttggttctcttttgatgtctcacttttttttttcttcttctacag
TTTTTTTGAAGAAGCAGGATGCTGATCTAAACGTGGAAAAA
gtaagttggcaagttttgcactgagagcaagtgccttgtgaattataaagggcttcctgt
tggaacctaggatgaagtccacttttaatttgggattgtaattctgagtccatagatttc
taagagagaggtcgagttggagaaggaactggtttgtgaaatagaaagaaaaccttacct

Exon  6 +      28565      28613   0    Initial     49    48    Marginal
cctatcctcaggctggtcaaggaggtcgttttcagtccattcattgttgtttttcctcca
ctctcagatggctgctgctcacctctgcctgagccgtatctttgaattgcagccactgtg
tagcaggtcattctttcattaatgtaacatttttttggttcctactgggtgttagacatc
ATGCTGGACTCTCTTGAGACAAAAGTGAATGTGACTGACAAGTACTCAG
gtaatgatggtacaatctgagagctgtgcagaaggggcttggaagctctgactgagggct
gagctatccagaaaaactccatgatggagtgggtgtgaggagctgtgaatgcattctttc
tctgaatgtttgctgagccttctctgcctgtacgtctctctgcctccccaggtgccttga

Exon  7 +      39971      40073   0    Initial    103    74        Good
agtagtgaggtaccactcagtagtaattggggcagcagtaatacaactgataaacttttg
tgaacaggaggcaaccctggggttggcttgtgggtgggagacctaggccagcactgccgc
ctgcagctcctgagtacaactcagcaaaaggtgtctgcactctgggcagacagattagaa
ATGGGCACTCCTTGCACGTTCCCTTGCAGCAAGGTTGGCACCACCTTCTGTACATCCCTG
CTGGGTTTCACCTTCCCATCAGCAGTAGCCTGGATAAACGCAG
gtgagtccttgtagagaacagaggtcatcaatgttgagtcttctgtttgattggagctgg
gaggcagaaggagcaagtgctccaactaagacgagtccaagcccaaggccctacagaggg
tcagagtactgggaaggaggcactgaggaaggtgggcccagggctcagggtaacataaga

Exon  8 +      44816      44929   0    Initial    114    92   Excellent
aaggaaatgagtccctgacatccccatgtgagcagcctcatcttctgaggccagctggtc
tggaggccagaggctcctgctttattcaacaaggagcatggagacagtgatctgttcttc
tccacatcctagcaccaagccaggcacagggtaggcccttaagcatctgatgaaggaatc
ATGCATGTATCCGTGGCATGTCTATTGCAGTATTTCATAGACTTAATGGAGCTGGAAGTG
ACCTTTGAGGTTATCTCTTCCAACTACATCATCCGACAGCTGAACAAGCCGCAA
gtcagggaagctaaataacttgtctaaggtcagacagcagtaaaatcagcttctcaacct
atgttttctgacttccattctcccagtctccctgtttttgctctactggaagtgctcagt
ctatggttcttttcctttctttcatttctgtgcttattggtgtctgttctgtgcttaaca

Exon  9 +      45307      45389   1   Terminal     83    90   Excellent
gagagacctgggctctcttccttgtctgctgcaccttaataagcattagtacatacttac
taattatcctacgttttgaatagcccttggtacttttcaggttcttttacaaatgtttct
aattagattttactacagaccggtgagataggttgagcaggtatttttcccacacatcag
GTGAGAAATCAGAGGCCCGGGGAGAGTACTACTTGTTCAAGACCACCCTGCTGATGAGTG
ACACAGTTGAGGATAGAATCTGA
ttctcctctatgagaggatgatggtgagttaagactgttttgaaaatctgacttcaggct
ctggaatctcgcctgcctctatgtaaatgtaaaaaataggatttcatgttttctaacagt
tttccatttagtagctcatttcgtaaagcatgttctgaagcacattggtcccaggagatg

Exon 10 +      50753      50777   2   Internal     25    77        Good
tttgaaatgttatttgacttctgagtattctatatccacagctgatgactttatgtactc
cttgctttcagttcctgaggcataatgtatgccgaactgattaaaaatagcattctaatg
aaatggttgggtgtgttgttacaatatacgtcagctacaaatgggaacttctttcctcag
GAAATTTGATAAACTGAAAGTCAAT
gtgagtgtttatatatattctgtgagaatgttttgtccttcctcatggcttccttttcaa
aatgaccagttaatttgggcttcccacccagacacatattttaacacttgtaatagttag
ctgagatctgttatgttagcatgatacaagagcttggattaaatgtttattagcagagcc

Exon 11 +      55400      55439   2   Terminal     40    89        Good
ataagaatttgaatgacttcagcaaggaacagaaaaggaataaaatgattctgcccgtac
tgataccttgtatttgtagatgtactgtagtttacagactccttttgggaatgttgtttt
attttatctgcactaaatcttaatgaaaatcacaaggctttttgaagactgaatctccag
GATTGCTGATGGCAAGCTGCATCTGGATGTAGGGGATTAA
ggggagagaagagaaggagacaactcactctgggtttctgtgcacccaaccaaaataggg
aatggaaagaggcagtttgggtgagaaaagatgatcaaacctagccaagactagtgagga
gagctgctgacagtgttaaatgtcaggtcctgggggatgagaacagtgaagtttagaggt

Exon 12 +      61202      61306   0    Initial    105    52    Marginal
ttagagtcctgcatgctagctcttaaccacagcactcaatacctctttcttccaagcaaa
ttccaataaagtgaaagttgaaggccataaaaagtatttgagaaacactgggatttcatt
tattgggatttgacctacattctttctgggaatattgtcaagatgagatatagtttgtaa
ATGAGGCTAGTGCAGTATGATTATTCTCTCAAGTTTGCATTTCATGAGTCATTTACTCAT
GCTGTGTTTTGTAGAGTCTTCCTGAAGGTGTTGGGTTCTCTGGTG
gtgagtatatctttcttaaattgctgctgtggtaggccttggtaaagttcaactgggttg
gatggggaagttctttgaactctttcaaaaatcaccaaactacagataatcgcaaatcta
gcagagggaaaatatcagttatttaactttgaaaacaaatccaactttgtattttagaaa

Exon 13 +      65133      65246   0   Internal    114    61    Marginal
ctccccagtgaagagggggattggcaggtgttggagggtgtcactgacatggcaacatct
ggctgagactttggtgcctgaaaaatattggaaaataaataaggttcatgttctgtggtt
tgatgttagtgccacctaacatctgccatgtgtttgtgaaataacctggtgtatccctag
GAGCTCACATCATTCCCCATGCCACGAAGCACCATGACTAATCCAGAGGACTCAAGAGAC
TCGTGCTTATTCTTCACTTATGCTGATGAAAAGTGCACATGGATACAGGGAAAT
gtaaatgtctctcattggttacccactgaaggtaaccatagagtagagaatggcaatcaa
tcgcgatgcctcctgagaactttttcaggttagtggaactgacgttagttgtgtggatct
tgaaagatgggataaagctattcttcaacccatttattttagactacctgaaagcacatc

Exon 14 +      68623      68707   1   Internal     85    73        Good
agctggttaaaaaggagaaagttcagtcaggctttgtgttttctacaatctaaattagat
gctagtgctggggcaccctaggaactgcgtgggaagaatgtggtgaccagtctacacgta
aaccccagcttcctactgcacccatcccacttccccgttccttttttcccttatctacag
GGTCTTCAACTGCCTCAAGAGCTGTTGTGGGCTCAGAAGAAAAGGAAAAGACTAGGAAAA
GCAGAAACACGCTGGAGGAACTACT
gtgagagccagctcctaagtggtcccagcttcccccacccctctgcctacttttttttcc
acttcaacttttacacggcctgtaattcagtcattttaatttgaggttgtaaatgacctt
taaagaaaaagcagtggtttcagagggggctgatgactcattaaatgatcagtgatgcat

Exon 15 +      71080      71136   0   Terminal     57    70        Good
tagccagtcaaagccataagcaaagactgttattcaagtttctgtgttaaccctttatct
ctgtggtctttccccacctaccccacacccccatgccccaggagtcactggttcaaaaca
ctatgaagtggattacttccttccatgatactaacagtatttatacttgactcttcacag
ATTGGAGAATATGAAACAGAATGTGAAACTAAACAGCTGAGGATATATGATGAATGA
aactggctgggatctgatcagttttataatttgcagtcctcaattcagagtagtttagga
ataagaaaacctcttggacatttattaatgttaccggttgacttaaaaaaaaaagattgt
ggggtaaaaccttacttccacagtcaagccataaaagtggcatgatttgggagagaaaaa

Exon 16 +      78468      78596   0     Single    129    40        Poor
atagaaaaagcacagtaaaaaatatcagcattgtaatcttaggggaccattgtcatatat
gtggtctgtcactgactgaaatttcattatgtggcacatggctgtacttagattggcaat
aaatacaattaaaagagaacatttgtggtgggcaagagctctagctcaaacgtcagacta
ATGAAGGTTCAAATCCTGGGTCTTCAACTTACCAGCTTTGTCATCTTGGCCAAGTTAAAT
GATTTCTTCTACATTCAGATTCTTCAACTGAAAAAAATAGTGATAGAGTCTAAGCCATTG
GGTTATTAA
taaggataaagtgaggtttatgttaagcctagcccagaacctggcacacagtaagtattt
agtaaatgttagctattattatttataaatcgtttcccttatttattgcctaactacaat
ctcaacctactctcaggaatatagaaatagaaattgattcatcatgagaaataatacata

Exon 17 +      88166      88337   0    Initial    172    43    Marginal
gtggcgattcctcaaggatctagaactagaaataccatttgacccagcaatcccattact
gggtatatactgggtgtatacccaaaggattataaatcatgctgctataaagatacatgc
acacatattgcggcactattcacaatagcaaagagttggaaccaacccaaatgtccatca
ATGATAGACTGGATGAAGAAAATGTGGCACATATACACCATGGAATACTATGCAGCCATA
AAAAAGGATGAGTTCATGTCCTTTGTAGGGACATGGATGAAGCTGGAAACCATCATTCTC
AGCAAACTATCACAAGGACAAAAAACCAAACACCGCATGTTCTCACTCATAG
gtgggaattgaacaatgaaaaaacttggacacaggaaggggaacatcacacaccagggcc
tgtcatgggttgtggggaggagagagggatagcattgggagatatacctaatgtaaatga
caagtaaatgggtgcagcacaccaacatggcgcatgtatacatatgtaacaaacctgcac

Exon 18 +      93188      93403   0     Single    216    66    Marginal
caggcctctgggcgttacagcatttgataggataatgtcgaaaagctggggtgagcttga
gtgccaggctaacatgactcgacaggtaaattcgcaggtcataggaagtggtggaaggtg
catccgttgaggaaagacaggctgtgtaggttgtgtttagaaaggattccttgtgcagcc
ATGAGAGTTGGATGGGAAGGGAAGAAACTGGAGGCCAAGAGACCAGTGTATGCCAGGCAT
GATGCTGACCAGATGGAGTGTAACGATGAGAATAGGGAGAAGCAATGTGTTCCCAGCACC
ACTGTGAAATTCTTGCGGGGCTGGACTGGGCCAAGGTTTGCAGTGGAGGTGAAGAAGGCG
GTGTTAGTTTACAGGCCCGAGGGACTGGGAGAATGA
tgataacagctcaggcttactgagtgtttactgtgtgccagaggctgttataagcccttc
tatgtcgtgtatgttctttagttgatatcatttaatcctcatagcaaccctatgaggtca
gtacagtaatccctattttacacataataaagcctagaaaagaaaggttaggaaaactgt

Exon 19 +     103554     103840   0    Initial    287    47    Marginal
ctttaactgtgttaacatgtcacaggaactctgtcagctcagtccctgagagggactgaa
gcagaactaacagataaatagcagtgactctccagatgggtccaggcagaggctaaagat
ctctgttggtcattctacttgtttttaccagaattattcttgagtttggagtgaccggga
ATGGTGCAGGTAAAGAGCTTCTCTAGACTTACTTCATCATGCAAGAATTTGGTCCTGCCT
CTCATTTTACACTTTAACCGCCTGAAGCACAGAGAGGTTGAGGAGGACCCAGGTAAACCT
TGCTATGGTTTGTTCCCACCAAATCTCATGCTGAAATTTGATCCCCACTGTGGCGGTGTT
GGGAGGTATTTGGGTCATGGGCAGCTGGATGCCATTCTTACGATAGAGAGTTCTCATGCT
CCCAATTCTGGATTAGATCTCGAGGGAATGGTTAGGGTTCTTCCAAA
gtgaggacacccctcctaggtttggcgtcttcacacatatctgccatgttttgacccagc
acatggccctcctgagaagctgagcagatgccagcactatgctacttgaacttgccagcc
tgcagaatgatgagctaaataaacctctcatctttatgaattacccagtcacagatatat

Exon 20 +     119998     120117   0     Single    120    48    Marginal
ttgtgtgtgtgtttgtgtgtttgtgttaaggaatgttttagtgggcacctattaaggaag
cctctcaggaaactactgtatattaaggccaaaaccaactgaacccatcatacgatttct
ctccctcaaggaaagcaaatgagaatgagcgactgtaacccttgcctgttgttcataagc
ATGTACACCAGGATCTGTGTGATCCTTTTCCTGAAGATAAACAGCATACTGCTCAAGGAA
GGAAAACAACGCATAGCAACAAATTTCCTGTTTTTTAAAGAAAGATCCAACTTGGTTTAG

aaattatgctggcttgctttctatgtttctaatagagaataaggagaaacttgcttctca
tttgccgacatgaggtaagtgttatgtctgaaagttccagagatcacagtttatacattg
aagaaaggtagtaaaaggtttgcgaagacctccttccccgtgggagaggtgccctactgt

Exon 21 +     124165     124260   2   Internal     96    74        Good
gaggagagaggaagagcctgcatccctaaaatttcttttctcaacaaatatttacttggt
tacctctattacaggcatttatggtcattgtattaattcattctcacattactgtaaaga
aatacctgagactgagtaatttataaagaaaagaggtataattggctcgtggttctgcag
GTTGTACAGGAAGCATAGCGGCTTCTGCTTCCAGGGAGGCCTCCGGAAGCTTCCAATCAT
GGCGGAAGGCAAAGGGGAAGCGAGGCATCTCACATG
gtgggagcaggagagagggctaggagaaaggtgctacccacttttaaacaaccagatctc
acaagaactcactgtcatgaggacagtaccaaggaggatggtgctaaaccattcatgaga
aactacccccatgacccaattacctcccaccaggcctcacctccaaagttggggattata

Exon 22 +     154258     154399   2   Terminal    142    69    Marginal
tgacttgattgaaggttgtattctggcttatccaacactcctgtgccctcttccttaaat
ttcctgtgccctgatggaagtttttattctaatgttgcatagactcattctacagagcat
gtattattttttttagatggctaaaggcagaattggtaaatatgattggaccgtctgtag
GCAGGTGTATGCTGTTACAGAATTTTACGAGATACAGGCCTTATTCGAGGAAAGTTGCTG
CATGGTGAACATTGTGCTCCGTGATGATGCTGTCATCCAGAACATATGGGGAACAAATGC
GATTGTGGGGTCAAGGAACTGA
acttcctcctaaccatctccccagccactgcctttcctcatgccccctaataggcctgaa
atagccaacagtgagccttgtcaattactcctcgtttactgtagagcaacccagcaacta
gggagcatcccagcttacgtgcccccttttttgtctttggcaggaatttagataatgggc

Exon 23 +     154636     154820   2   Internal    185    66    Marginal
tgaaatagccaacagtgagccttgtcaattactcctcgtttactgtagagcaacccagca
actagggagcatcccagcttacgtgcccccttttttgtctttggcaggaatttagataat
gggctgtgtgcaatgtaaggataaagaagcaacaaaactgacggaggagagggacggcag
CCTGAACCAGAGCTCTGGGTACCGCTATGGCACAGACCCCACCCCTCAGCACTACCCCAG
CTTCGGTGTGACCTCCATCCCCAACTACAACAACTTCCACGCAGCCGGGGGCCAAGGACT
CACCGTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGCGTACGAGAGGAGG
AACAG
gtaagcccccaaagtcacagagtgcagagagggggcagccacccttaaatcttttggcaa
ttgaacatctgggttcccatcacttccctttgactaggggtttcacatgtaagtttctaa
tctgtctcctctactagatgaggggttgtaagaaaagccagagtttgatgtacaaacaaa

Exon 24 +     158275     158355   2   Internal     81    95   Excellent
gaagtatcaactagtgggagacccaggtttataactgtactaggtacacagagggtgctg
cgttcagcctgggctttcacaaagcagtaatattccagggagcatagaaccagtgatacc
gtgacttttaaaaaataaaacaaaaacaaatttatcttatgactatgtaattttcactag
AATCTACACTTCTCAGAGCAGCCAGGACTTTGGAAACTATGAAATGTCACTGACATTTAT
CATCAAATACAAGCATAAAAT
gtaagaactaaaaaatactcaaaagaaataactgcttagccctagcttctgagctaggag
gatttgggctgtggaaacagggagggccagcaacctgtcccagcacaaaagaaaatagac
tctgaggtagataactgatcatacacagctgaccagacaagtacacagttttggaaggca

Exon 25 +     158915     159061   0     Single    147    40        Poor
tcttccttcatgcttttttgtttatgtgtgtccatacatcaattaaaattataaaaccta
aatttacagtttctgtgggtcaggaatctgcgaatggtcagttcggtccttcagaatctc
tcacaggctgtaatcaaggtacgttggctgggctatagtcatctcacagtttagctgaga
ATGATCTGCTTCCAAACTCATGTAGTGCTGGCAGGATTCGGTGCCTCGCTGGCTGTTGGC
CAGAGGCCACCCTCAGTTCTTGGTCACATGGGCCTCACCAGCATGGCGCCTTGCTTCATC
AAAGTACACAAGCTGAAGTGGCAATAG
agagagtctgctagaaagacggaagtcaccatcttttgaagcctagtcacttaagggact
gcacattctgttgagtagaagcaagtcgttagatccagcccacactcaaggggaggggct
tgcacgagactgaatactaggaggcaggagtcactggggactatgctagaattatgcctg

Exon 26 +     160182     160282   1   Terminal    101    91   Excellent
ccaaggcataaacacagccctgtgactgtggttttgacacgttaattacaacacttcatc
atgttattagtgctggctagatgtagattgtgagaatgagattttagtgaagatttaatt
tcttggaattaatttccccttgtgtaataatctcccttcttgtgaatttcgtttcggcag
GAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCACGGACAGAAGATGACCTGAGTT
TTCACAAAGGAGAAAAATTTCAAATATTGAACAGCTCGTAA
gtttggagagggaggagaagcatgtatacctttcaggttgggaaggggtcttgcatttct
ggtctgcatctcttcagatgtctgaaatgctaaaagaacatttgctaaattcactggttt
acaacaatatactttgagaaaaagaagagtcagtgacacagtgcagtattttatggcact

Exon 27 +     161986     162168   0    Initial    183    59    Marginal
ctgtgtggccaccagccaggtcaagaagagtgttacctgccccccaggagtcctcctcct
gtagccacaggaagtttttaaaaaataataaacagctaccattcattgaaggctcctgat
gtaccagccatgagctaagttacaaacattctcatgcattcttccactactgtctgaggt
ATGCATCGACGTCATCGTTTGATATCTGAGGAGCCAGAGGCCCAGATTAGGAAACTGCCC
CAGAGCACAGAGCTGGCAGGTGGCAGAGCCCAGGGCGAGGTGCAGGGAGGCATCCTGAGA
ACAGTGTCAGGTTTGATCTGGGAAAGGCCCAGATACTTTATCAAAGGGGATGGGAACCTT
CAA
gtgacaggaagctttggagagttgactggggctggggaggaggggattgggctttgatct
ctctgggtatacctccttgctgttattttgctgcttgttggagtccattaactttgaatt
ctgaaatcctccgccccttagcctcccctacatgccaaggttgattagaaatttcaagac

Exon 28 +     163082     163143   0    Initial     62    56    Marginal
gcctctggctctggtcctcagaggagagggaggaatggggctctgttctgccagggcagc
tgccacacctcctagtgtgtgtcctcccactcccttccctggtggagccctggtggcgct
ggaggccacagggctggctttgttaaagtacaacatacaccgtgggatgtgcatgtatgt
ATGTACCCAGAGGCGGTGTTCCTGCTACCCAGCAAGGGGCAAAGGTGCTTCATTGACCCG
TT
gtaagtgctcagtgtcatgtattaggacattattaaatttgaaccccttttgcaaagtat
ttaagttcatccattttattccttgttttcacatttcaagactagtcgtttaccatctac
gaacagtgactctttaaaatgtaatacatgttttacacagagtggagtattggtcacagc

Exon 29 +     163495     163794   0   Terminal    300    52    Marginal
ggtcacagctgagggtaggtttgttgttttttttttcctattgtgataaaaagaaatcct
ggtttagagccccacccaagcatttgataaaattgttaccgacataaaatgctacactac
tgagcagatcaaggctgacttctgttggcaaataactactccctggctccaaggctctag
GGCTCCCAGCTCCGGGGCCCACAAGCCTACGAGCAACTTTGGGGTTTGGGGGTAGACACT
TTTCTTGGTGTGGGGTGTGGTGGGGGCACAGAATCTTTTAGCAAGTCTTTAAATCAGAGG
AACAGAGACAGCTGTTATAAAACCTTAAAAGCCATTCTAAACCAGCGCCAGGCTTTAAAT
CATATATTTGAATTAGAGCAAGATAACAAAGAATATCTCACCAAGTGCAAACTGAAAAAT
CTGAACTATAAGAACCGTTTAAAGAAATACAGCTTTAACAATGCTAATTACCCACAGTAA

ctcaagaaataaaagataacatagtagagatcctattttcctaaatcaacatgaatatag
agtatatctatttataggtgaattggtgcttctagtgtatcaaaaagatgacttaattca
ctcgctcaacggctctcaatgaatattttgagtctgtaccagcctctctaggctcaacat

Exon 30 +     166605     166703   2   Internal     99    64    Marginal
cgaactggaaccttctgaccttcacagggggactatgttggagttcagagtaaaggaata
ggttggagaaatcgggtggcaggatgattaggtgacagttatacacttcagaccacagtg
agtctctaactgcaagctgttgaaatggtcaacatatttacttttcttttttatttacag
GGAAGGAGATTGGTGGGAAGCCCGCTCCTTGACAACTGGAGAGACAGGTTACATTCCCAG
CAATTATGTGGCTCCAGTTGACTCTATCCAGGCAGAAGA
gtatgtttcattttgttttcacttaactacttgattttaaaagttgattgccgcaataaa
atgccatcagcattgggcaggagggagaagaaattcacagcagtgattaaggctgagttt
ttcaggctttctgccccggtttttaccctgtgtaatacttgcactattattaacttaatg

Exon 31 +     171591     171724   1   Internal    134    65    Marginal
tctgacatttgcagaacatcaagaagcatcttcttcctgttactgagtggagatgctgtg
tgtgtgtacatgtgtgtgtgcatccttggtaattattaatcagagtcaagaaaatgaggc
ctaaaaagcaagctgatactctaaatgattggagctgctaatgctttccacgtttaccag
GTGCCTATTCACTTTCTATCCGTGATTGGGATGATATGAAAGGAGACCATGTCAAACATT
ATAAAATTCGCAAACTTGACAATGGTGGATACTACATTACCACCCGGGCCCAGTTTGAAA
CACTTCAGCAGCTT
gtacaacattactcaggtaaccttaattctaactacctactaaccatttggatgctggag
ggagtggataggcccagagcaggaaagtggaaaggggtaaaactaatatgtacaaaatca
cttatagagtatgttttctttgccagcccttaatggtagggcttggctgtataggttcta

Exon 32 +     174357     174591   1   Internal    235    56    Marginal
gcgctgtttaaggagcgctgtgtgctgctagtgttccacgatgtgtgtggtcgtctgctg
gtgtagtagcactgtttgaggagcactgtgcgccgctagtgtgggtttacacttatgagt
gttgtcattacatgtgttctgctcttctctccctctcctgcccctgccctgctccatcag
AGAGAGCTGCAGGTCTCTGCTGCCGCCTAGTAGTTCCCTGTCACAAAGGGATGCCAAGGC
TTACCGATCTGTCTGTCAAAACCAAAGATGTCTGGGAAATCCCTCGAGAATCCCTGCAGT
TGATCAAGAGACTGGGAAATGGGCAGTTTGGGGAAGTATGGATGGGTATGCTGAGACTCA
ATTACTCTCTTATTAGCTTCCCCGTTTGGAAGATCCCAAACACCAAAGATGGAAG
gtgaaaataaagactgcgtgaccgggaagaaagtttgaattactaatagtggggaataat
aatttcagttttggttttaacattctggaattcctaaaaaaaaaaaaaaaaaaaaaaaaa
gatagtaagtgggcaaaattggcaaatggctcaagttgtactattacatgactctcaatt

Exon 33 +     177524     177697   0   Internal    174    94   Excellent
gaaagagacccaaaagataatccagttccattcctatattttacagatgaggtaactgag
gacaatcataatccaggccttgccttcagatttgctagatttttttttaacatgctaaat
ttaaatatttctgttccctctcagctgctgtttaatttcccctgtctacctacctgacag
AAGCCATTGTTCTTGTGGCTAGCCATCAGTAAAGCTGAGGAAATTTGCCTTACCTTGTTG
AAGTATTGGCAAGCAGACTGTGAGCTCCTTGCCAGTGCTTATCAGCATGCTTGGCACACC
TGTGCAAGGACTCAGTCAAGTAACTTGTCCATTGCAGACATTGAAAGTCTAGAG
gtaatttccagacatcctcatgtggtgccatatttttaaatggcacaccccataaactta
aataatctaatttcttccatgcacactgtactccctaagggacagctattagatggccag
gcctgttccaacccctggactttcatcactgtatggtgcagagcttttggtataaatgtg

Exon 34 +     178099     178348   0   Internal    250    99   Excellent
atcaaaatttaaaaaaattttaatgagttataaatcttaatatagccatcttagccataa
ccacaaataaactcattttttctgttaaaatacttgacagagtccttgcaattgaatgtc
tttgttcaacaaaaactgtattaagtgttttaaatttaaaatctaatcttatgcaaatag
CTGGTGGTCAAAACCTTTTTCCATCAAAAGAAGATCTTTGGTTTGACTTCATATTCTGGG
ATGTTTGTAGGTACCTGGAATGGAAACACAAAAGTAGCCATAAAGACTCTTAAACCAGGC
ACAATGTCCCCCGAATCATTCCTTGAGGAAGCGCAGATCATGAAGAAGCTGAAGCACGAC
AAGCTGGTCCAGCTCTATGCAGTGGTGTCTGAGGAGCCCATCTACATCGTCACCGAGTAT
ATGAACAAAG
gttgggcaacacctctcctgtctccagctcacagtgccttaaggggttgtttaggggaga
gaaatggaagtttcctacttgctacttttctagtttctgcctgggtcaagtattcccatt
aggaaccaccagttatgtgctcgttaatgaaaacattttttaaaacagactaaccttgcg

Exon 35 +     179921     179997   1   Internal     77    55    Marginal
cttctccatgcctatacttttttctaccctgcttttttatataaacctttttgtcccccc
atgtggatggcattattccatttgactaccttattacttttaataagaaaaccaaataca
gctctctgttgggaattatctttcaaagtaaattgaaatgattttatgttttgttcatag
GAAGTTTACTGGATTTCTTAAAAGATGGAGAAGGAAGAGCTCTGAAATTACCAAATCTTG
TGGACATGGCAGCACAG
gtaggccctgcagggtaacttgatgtgccatagatttaatgacgtgtctaagtacattgg
gtcgtggtgtaacatgtcctgttccctgggtttccacaggtggctgcaggaatggcttac
atcgagcgcatgaattatatccatagagatctgcgatcagcaaacattctagtggggaat

Exon 36 +     180097     180279   0   Terminal    183   100   Excellent
ataggaagtttactggatttcttaaaagatggagaaggaagagctctgaaattaccaaat
cttgtggacatggcagcacaggtaggccctgcagggtaacttgatgtgccatagatttaa
tgacgtgtctaagtacattgggtcgtggtgtaacatgtcctgttccctgggtttccacag
GTGGCTGCAGGAATGGCTTACATCGAGCGCATGAATTATATCCATAGAGATCTGCGATCA
GCAAACATTCTAGTGGGGAATGGACTCATATGCAAGATTGCTGACTTCGGATTGGCCCGA
TTGATAGAAGACAATGAGTACACAGCAAGACAAGGTGGGCACTTGAATGACAATGGCTCG
TGA
tcacagctgtgagaacagtcacttactgcacagcccttccttcctccttcccttcccttc
cttcagaaaatacttgaaatgtcattcttcagcttggtttggacaccttgatctggcagg
aatttgacagctctgcaggtgggagactgttgtgggcccagtggagggatgagatattgg

Exon 37 +     185965     186067   0    Initial    103    57    Marginal
atccactgtcctcatctccggccagcttgcctattttctcatatttgcattctctgttga
gaactatccctgcctctgcgctgcctctcttgtttttaatcttgtgaagtctgaatatca
gatgggccttctcagcattttcactgaggcatgtgcatacacacatcaacatgagcacac
ATGAGCACACACACGCTGCATGAGCACACACACGCTGCGTGGGCACGGCTGGAGCAGTTC
TCCCGAGTATCTGTGGAGTCGGTCTTACTGCTTCTCTATAGAA
gtgatttagtttaaagactagcagcgggcccttgtagacacagagcacatagtagtattt
aataaatatttgtttacagcaatggaaataaccaaggtcaccaacccccccacactcttg
tgagacatgctctcctgctgtctctcatcaatgtgcatggctctctctgggaatcaaatg

Exon 38 +     191860     192054   0    Initial    195    41    Marginal
aactcagggactttaggcctttactatctgaataaaataacagctggtatttattcagct
attaccaggtaccagacgctgtgctgagccttttacatcaactgttcttcccaccacaac
cttaggaggttatcatccccagtttacagacaaggaaactgagacttagggatgttttaa
ATGATCAACCAGCAAATCCAGTGTGCAAGCACAGGGATACCTGACTCGGAAGCTCCTTTC
CTAAATGATCATAGTGGTCCTTCCACAAGTGACCACTCAATCCCAGCTCAGCCCACAATC
GGACCACTTTGCATTGTCACTGAAGAGCATCCACTCCTCGTTTCCTGGCCGGCTTATGTA
CTCTTACTGCAGGAG
gtgatttggcagcaaaagtatctgcagtcttcattggagcatttgaaatgcccatgccat
catcttaatgtatgaaaacacataaagaacaggaagtaactgagtcaagtaagctatttc
tatttgaggcagaagtgaaaaacagattacctggccactagggatagagggacttcatta

Exon 39 +     195131     195252   1   Terminal    122    57    Marginal
ccagacagtgacactggtgctgtcaccaaggacaagtagaagactcaccagagggcaggg
aactgataatacgctctgtaaggaactgtggttattcagccaaaaagggaagggctggga
gggctgaccagctactcattcattcattcagcacctgtttatcaagtgctttctctgcag
CAGACACTGTACTCAGTACTGGAGATGTGGCCATCTGGGAAGACATGCTCCAGCACTCAA
GCACAGTATTTATCTGGGGCAGAGACAGCCTTCAGACAATTCATGCATTCATTGCCCTTT
AA
taataacagcttcgttaggcaatatttactgaaaaaaagtagtgacaactacaaagaggg
aggtgctctggcagcatagaagtaggaaacctaccgcagtctttagtgatcaggcaaagg
ttccctgtgcaagtaacactttggctaggagcaaaagagaagtaagaattagccatgggt

Exon 40 +     195513     195586   0    Initial     74    51    Marginal
agtaggaaacctaccgcagtctttagtgatcaggcaaaggttccctgtgcaagtaacact
ttggctaggagcaaaagagaagtaagaattagccatgggttaagggcttttgataaagga
aatagcctgtccgtgaagcaggtaggagcttggcatttgcaaagcagtcaaagaagggca
ATGGAGAGGTTGCAGAGGAGAGAGGAGGGAAGCAGAGGAGAACAAGTCTGGGATGATAAG
AAGCAGCTGGGGAA
gtaggtagggaccagattatgcatgtagattctattagaaggctactatagaaacccagg
gggggacatgctgagcaagcgaggactagaggaagggtagtgaattcaagatcatgaaat
ggtcaggatgtaatggacctgacacgggcagggacaaagcaggagagcacagagatcatt

Exon 41 +     199995     200113   1   Internal    119   100   Excellent
cacagtcaagaccagaccctacatcttcccaatcccagcccattcctgcttcacctcctt
tctgtcttcccctctaaacctgctctcaggaaagtagcttgccaagtgcctttccctccc
acaccccatgcccattgcagtgccctctgcctgatgaataaccaagtgttcattctgcag
GTGCAAAGTTCCCCATCAAGTGGACGGCCCCCGAGGCAGCCCTGTACGGGAGGTTCACAA
TCAAGTCTGACGTGTGGTCTTTTGGAATCTTACTCACAGAGCTGGTCACCAAAGGAAGA
gtgccatacccaggtaagagcagggcctcacagacatgggcctgagattggaggcttttt
tgacaccatttgggaaaacttcatccactttgctttctaagccccatcctcagctttctg
ctgagcttgagtttgaagaacatggccaggtattcagcgagagaaaagcagaactgggag

Exon 42 +     200227     200325   0   Terminal     99    61    Marginal
gttcacaatcaagtctgacgtgtggtcttttggaatcttactcacagagctggtcaccaa
aggaagagtgccatacccaggtaagagcagggcctcacagacatgggcctgagattggag
gcttttttgacaccatttgggaaaacttcatccactttgctttctaagccccatcctcag
CTTTCTGCTGAGCTTGAGTTTGAAGAACATGGCCAGGTATTCAGCGAGAGAAAAGCAGAA
CTGGGAGCCACCATGTATGTAGACAAGCAGCCACCATGA
actgtgtgccaggattaatgtaagtagcagctggtctaaatgcttcagtccccctccagt
tcatagaatctctcctctctcagtaggagtatgtgtctgtggttcccagagcagaaatgt
cactggcagtgcctctgcccaaatggagtttgcagacatgtctgggaaagagaaggagaa

Exon 43 +     210006     210110   0   Terminal    105    45    Marginal
tcatatactccccttgctttgagaggtctgggcagaagaaagcaggagaagaagaggagt
ggggaagagcggaggggtgcagacaggaaaggggagagcgagaaggagcctgaccatgtg
ggtctgccaggaccctgcatgggccagcttatgccctgtcccctggctccaaatgcccag
GAAAGACTGCCTCGGGAGACGCTACATGTTGAGGTTCACATCACCAAGTGTGCTGTGTCT
GAGGCTTGGACCGAGCACTGGAAAAATGACCCAGTGGCCAATTAA
actttccattggcagacattggatgaaaactttttttttaagtgaaatctttccatttga
gtagtttgttttttaatgaaatgaaacatgtactgacatgcgctctgtggagcaatagga
gagtgattaattaaactctgtgctgccattttggagggaggcactcagagccagagtcaa

Exon 44 +     212678     212886   1   Terminal    209   100   Excellent
agttctgcactccttctttactcctgagtagcatggcagggtttgactcctggggggatg
ggagtactccgcatgttttagccacatgcagacgcaaagaagaagaaaggggatctgcaa
gtgcggcggtcagggcctggatccccggggtgcccactctcactgcgcttgtctttgcag
GCATGAACAACCGGGAGGTGCTGGAGCAGGTGGAGCGAGGCTACAGGATGCCCTGCCCGC
AGGACTGCCCCATCTCTCTGCATGAGCTCATGATCCACTGCTGGAAAAAGGACCCTGAAG
AACGCCCCACTTTTGAGTACTTGCAGAGCTTCCTGGAAGACTACTTTACCGCGACAGAGC
CCCAGTACCAACCTGGTGAAAACCTGTAA
ggcccgggtctgcggagagaggccttgtcccagaggctgccccacccctccccattagct
ttcaattccgtagccagctgctccccagcagcggaaccgcccaggatcagattgcatgtg
actctgaagctgacgaacttccatggccctcattaatgacacttgtccccaaatccgaac

--------------------------------------------------------------------------------