--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (61656 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (26 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      10047      10198   0    Initial    152    45    Marginal
ttttccaggttgaaagcccacatcagggtccttggctgtaagcaacagcatccaaatgtg
gttaccttaggtagaacagggcagacagcctggaaggctggagagccagactcaggggca
accttggcaggagcagatgctgtaagtggtcagtgagagcatttctggggctaccgcaag
ATGCTGATGCTACAGCCAGTGGACACTGAATGTGCCACCAGCCCTGCTGCCTCTGTTGCC
AAAGAGGACACTCTAGGCTATCCCTGCAGCCGGCGTGCAGACTTGTTACACGTGGGTCAC
ACCCATGTAGCAGCAAAGGCTTACGTGAGCAG
gtatctggcattggcagcttctatactaacagctgggctctgcttcccaccaagactccc
tggggccagggtatccccaaacctaggaaagggtttcagagactggaaaaccaataagat
aaatggccattacagggtttgtggttttcgagcatacccaagggataaaggaccccaaac

Exon  2 +      11160      11262   2   Internal    103    92   Excellent
attagaatgtagagacggtctactcttatgccctcatttaattttaaagataatataaaa
tgtattaatttgtgcttagtagagaagatagtagatgtacaaagaaaaaaagcaaaaatg
ggccataatctgttttccgaataatccctcttgatttaaaaaaagtgcaaattggcatag
TGCATGCACAGGACTGGAGTGTCAGATGGCGGAGGCAAGCTCAGAGAGAAATGCAGAAGC
CCTCCTCCAGGACCCCGCCATCGCCGTCACGGAGGTGAGCATG
gtgacgaagggagtgtacgtgcacacagctgtacctttcctgtttttcataccattttca
agatatattaagttaaaacgcgtaagatcgtcttcctcacagccccacacatcttaggcg
tcgtattccatttcatggcacctaacttggagtctggatagtggccagtggccacagtgt

Exon  3 +      13732      13765   0   Internal     34   100   Excellent
aacccacggccttccacaggccgctggggatgttgggtcacccgcgtgtctgtcagggag
gtgctgtactggggaagcacctggcctttgcagggatcctgctgctggatgaggccccct
tctgcaataccatccacttagagtctgccatgctcatgtctgtgtctgtctctctcctag
ATCCTGCCCGGCCTGTACATCGGCAACTTCAAAG
gtgagttcttgcttttttattgttgtgataaaatacacataacataaaatgtgtcatctt
gaccattttaaagtgtataggtcagtggctttaagtaatttgcattgctgtgcagccatc
accaacatccttctgcaggacttttcatgttcccaaactgaaactgtgtcccttaaaaca

Exon  4 +      15857      15942   0    Initial     86    53    Marginal
gttgtgttttattcactcgttagccaaatatttattaaacgctttccaggtacaaggctt
atctaaaagaaaggaatgagagtacagtgaattggcgagtggctcgaaggagaggaagta
ttttccccaattgtgctgtgaattcacttgttcattgcacaagcttatcgggaacacacg
ATGTGCTGGGAGTTGAATGTGGACCAGTGTCCCTGCCCTCAGGCTATCAGAGTCCAACAG
CAGGTGCAGAACAGGAAGGGGCCAGT
gtgtgtcctcacatgagttacacacctgggggtgtagactgggaagatggagtctgtctc
acagggctgtagcggggctgacccagacaatgggtgatgccctcggtgggctcagtgccc
aatacctggtgccctgataaataagcacccacacactcactgctactgccatgggagccc

Exon  5 +      17538      17613   0    Initial     76    41    Marginal
aatgtacaagcttgtgtctgtgcacattaggaaactccaccttgagccttacagctggat
tcccagctcattacctcgctgctcatgattgtaggtcgccttccaggacaaccaatagtg
tgaagtctgtaagaattaaagttccagggtcatcacccagcaggtttgattaagcatttt
ATGCACTCTGAAGTAAGTGGGCAGAGCCTGTGCCTTATGGGAAAGGATGCATCAGCGAAC
ACGGTGCTAGCGTGCG
gtgaggaagaggggaggtgctggccccggagtgcttccctgtgctttggagtccagccgg
cagtgggctgtcgtgatatcaagtggtcttctctattcagaaatgtatgcttttttcccc
aggccactttaaaaagattcactctgtattatcaaagcatatttacggggtgaagaaaat

Exon  6 +      20984      21066   1   Internal     83    90   Excellent
aagttaggcaaaatatatgaaagcagtagccctaagtttcctacatgtatggtcagttat
gaagtttcaggaaagaaatatgcaagtcattttgtgggtttttttttttttctggctaga
ctttaggagtaattaacttgcaaagatatcaaaatgtccatcccctttcttctctgacag
ATGCCAGAGACGCGGAACAATTGAGCAAGAACAAGGTGACACATATTCTGTCTGTCCACG
ATAGTGCCAGGCCTATGTTGGAG
gtaagagagcaccgtggggcgtgtgtgggtgtcctcatttgtattccgtgggagtaccta
cgacgttaatgaaggcaaccaggttctctccaatgcgaacgtactcctgtgatctctggc
ggcattcccattgtgttcaggccgtgttgatgttaacacgctgtctgtagcgtggcgcga

Exon  7 +      24612      24705   2   Internal     94    50    Marginal
ggtctagagatcagcaagcctaactctatcattgggtggacaaaaacctggacgttggga
gacaggaaaggacttgcctgggattcccatggctgtctgggtagcttgatgggaagccgg
gactcctctcccagactggggattttcccagcatgccccactgcctctgttctctcctag
CACGACTGATGTTTCTGATATCCTTAGTGGTATCGGTAGATCTTACCAGATCACCTTTGA
AAAAGGTTGTGCTATTTGTGCTTGTACTAGCAAT
gtatgaaagtgcctttccctgccatgccatcaccagcacagagctttgctcttctttcct
tttaattagcaagatttttgctgttatttgctgcaaataccctcttcacacatcccgtcc
ctttccagaaagttcttccctttgaagacaaagggttactgatttattcatttcttgagc

Exon  8 +      28894      29111   0   Internal    218    69    Marginal
ccatttgcgttggccattgtttccagcgtgggtgaattcagctatcttaccgaaaaacac
tgtgggtgtcaagttgctagaaaggtccaagtcttttgaaaaccagttgctgtttgacct
ggaatggttttcagattgacagttgtttccagcacacctcagttgttttcatctctctag
GAAAACCTCTTTGAAGCCACCCAGAATCAGTGGTACTTTGCTGTACCAAAAGCTTACAGC
AGCTTTCGTGTGTTGAGGCAAATTTGTTTGAAGCCAACCCCAGATTTAAATAGATATGAC
TCAAATAGAAATGATTATAGCAGGGATCGAAAACTGTCTAGTAATCGCTCTTTCTTGAAG
CAAGCTGTATCTAGGTTTCTCGTGTGGCAGTCGGGTGT
gtaagagcggcccctccactggctggtcctgctaccacagactcacttgcaaatggagcc
ctagaactcctgcatggctggactcagagggcttgagatcttccagtacttaactgagtc
tagggaggacatggttttttaaacttctaaatcaaagaactcttttggcctggcttccta

Exon  9 +      32426      32561   2   Internal    136    84        Good
ccttattacaggctgtgaacaagctctgtccatgcttttaaaaatgtgttcccctctgtg
tggccagactccctgggatgttttaaaggcgtgtgtgcatgtgtgtgtgtgtgtgtgtgt
gttgaggtggacagtatcaaaccctaggtttgaattgagaagttatttccctcctttcag
TTATCACCGCAGCTACTGCCAGCGTCAAGTTTCAGCATTCATCACTGAGCAGGGGCATCG
CCAGCTAGCTCTGGCCTTCTTTTCCCATGGGAAAGCAAATGAAATGCATGGTGAAAGTTC
TGGGCGTGGGAACGAA
gtaggtgcatctgaaatctgagttagagcttctttctcttgaggtccaactttttgttct
caggtttttccccggctagtgggggttaatccacaaggcccttggctccttccgtgagag
gtgcagccactatcagtgcaaggagaggacgcggggaagtggctcttagggcgtcccttt

Exon 10 +      33370      33517   0    Initial    148    56    Marginal
aggtttcctgccttttctgatggaaacctctgcagctgctcctacttcagcagtgggctt
gcagccgcatggctaccccagtgagtgtcctctagcctccttggtggccggagcactctc
ttcccctgtgcttccacatgtgggctctgaccgaggtgacctagggcctccttctgtgcc
ATGCTAGCAGCGGCAGGCGTGGAGAGGGTGGAGGGCTTGGAGGAGTGCCGCCCTTCCTGG
GGAGGCCTGGGAGCAGTGACCCGCTCATCCTTAATCAGAGCAAGGAACACGCTCTCCCAC
CCACACCTGCTGCCGCGAACCTCAGGCA
gtgagtgccgcggagcacaggaatgcagcacgtctctaatattaacttgctgcataacag
aggggtgtccctcctggtgttgaggagaaacagaagagccgctgttctcatttctctcca
ctctcccaccccgtggacgttctttctgccctgagctcccgtggcactcaccacgtccag

Exon 11 +      33879      34451   0    Initial    573    47    Marginal
ctttgcgtgtcttgagcctcagccctgcccatgcagaactggccagccctggagggcagc
accctgctctgggtcagtgtttgcctctttctcaaaacagcttctagagtatgatcccag
agggaggatgtggtgttcggctggagggatcatccgtgctgtttagaaagggcttcctag
ATGCTGCAGATTGTGTCCAAGCCTGAAGACAAGCGGCAGTCTACAAAGCCTGTAACCCAT
CTGCAGCTGAGGGACCCATTCCATCACCAGCGAGGGGCTCCGAGAGCTCACTGGCTTAGC
CAACTGCAAAACAGGCACAGTGTTCCCAGCAGCGCTTCGTGCCTCCCTAAGGAGGGAGCT
GTGTTTAAGGCAGGCTGCCGCATCCTGCCGGGAAGGGGAGGCTGGCTCAGGGAGATAGGT
ACAGCACACAGCTTGAAGAGCAGTGTGGCCCTCTCCCTGCTGGTGCCTGGAGAGTCATCT
GCCCTGGGCTTCCGCATCCTCGTGTGTGCAGTGCTGTACCTGCTGGTGCCTAGAGAGTCA
TCTGCCCTGGGCTTCTGCGTCCTGGTGTGTGCAGTGCTGTATCTGCTGGTGCCTGGAGAG
TCATCTGCCCTGGGCTTCCGCGTCCTGGTGTGTGCAGTGCTATATCTGCTGGTGCCTGGA
GAGTCATCTGCCCTGGGCTTCCGCGTCCTGGTGTGTGCAATGCTGTATCTGCGGGTGCCT
GGAGAGTCATCTGCCCTGGGCTTCTGCATCCTG
gtgtgtgcagtgctgtatctgctggtgcctggagtcatctgccctgggcttctgcgtcct
ggtgtgtgcagtgctgtacctgctggtgcctggagagtcatctgccctgggcttccgtat
cctggtgtgtgcagtgctgtatctgctggtgcctggagagtcatctgccctgggcttccg

Exon 12 +      34773      34949   0   Internal    177    68    Marginal
tctgctggtgcctggagagtcatctgccctgggcttccgcgtcctggtgtgtgcaatgct
gtatctgcgggtgcctggagagtcatctgccctgggcttctgcatcctggtgtgtgcaat
gctgtatctgctggtgcctggagtcatctgccctgggcttctgcatcctcgtgtgtgcag
TGCTGTACCTGCTGGTGCCTGGAGTCATCTGCCCTGGGCTTCCGCATCCTCGTGTGTGCA
GTGCTGTACCTGCTGGTGCCTGGAGAGTCATCTGCCCTGGGCTTCTGCGTTCTGGTGTGT
GCAGTGCTGTATCTGCTGGTGCCTGGAGAGTCATCTGCCCTGGGCTTCCGCGTCCTG
gtgtgtgcaatgctgtatctgctggtgtctggagtcatcttccctgggcttctgcgtcct
ggtgtgtgcagtgctgtatctgctggtgcctggagagtcatctgcgctgggcttctgcgt
cctggtgtgtgcaatgctgtatctgctggtgcctggagagtcatctgccctgggcttctg

Exon 13 +      35209      35325   0    Initial    117    53    Marginal
ctgctggtgcctggagagtcatctgcgctgggcttctgcgtcctggtgtgtgcaatgctg
tatctgctggtgcctggagagtcatctgccctgggcttctgcgttctggtgtgtgcagtg
ctgtatctgctggtgcctggagagtcatctgccctgggcttccccgtcctggtgtgtgca
ATGCTGTATCTGCTGGTGCCTGGAGAGTCGTCTTCCCTCGGCTTCTGTGTCCTGGTGTGT
GCAGTGCTGTATCTGCTGGTGCCTGGAGAGTCATCTGCCCTGGGCTTCTGCGTCCTG
gtgtgtgcaatgctgtatctgctggtgcctggagtcatcttccctgggcttctgcgtcct
ggtgtgtgcagtgctgtatctgctggtgtctggagagtcatctgccctgggcttctgcgt
tctggtgtgtgcagtgctgtatctgctggtgcctggagtcatctgccctgggcttccgcg

Exon 14 +      35521      35697   0   Internal    177    68    Marginal
tatctgctggtgcctggagtcatcttccctgggcttctgcgtcctggtgtgtgcagtgct
gtatctgctggtgtctggagagtcatctgccctgggcttctgcgttctggtgtgtgcagt
gctgtatctgctggtgcctggagtcatctgccctgggcttccgcgtcctggtgtgtgcag
TGCTGTATCTGCTGGTGCCTGGAGTCATCTGCCCTGGGCTTCTGCGTCCTGGTGTCTGCA
ATGCTGTATCTGCGGGTGCCTGGAGAGTCATCTGCCCTGGGCTTCCGCGTCCTGGTGTGT
GCAGTGCTGTATCTGCTGGTGCCTGGAGAGTCATCTGCCCTGGGCTTCTGCGTCCTG
gtgtgtgcagtgctgtatctgctggtaattatgcagatgggattgcccttgagggagagt
cactggcaaatcctgtctactaccatttattgagcatctactgtgttctggcactgcact
tagtatttttcacatgtcacattgactttccttgtttaaagtcctgtgttcaagggaaat

Exon 15 +      38173      38387   0    Initial    215    45    Marginal
ataggcatacgtaagtttttccaggtgtaatcttccttgggatgggatttcgaattctgc
tttttccctttaaccttacataatttctacaaatgttatgggctatgtgaaagtcatacc
tggaggagaaataatcaaaatgcatgtgccacgcaccgagctgggctgccacacacgtaa
ATGAGCATTCTCTTATGCTTTCTGTGGAATAAAGACACCTTGCAAAGAGGAGACAGCTCA
TCAAACCTGCAGGGTGCCTCAAAAAGCAATTTCAGGTTCCTGATTGCCATCTCCTGGGTC
TACGATCTTCAAGAGTGTGGCCAGACGGTTTTCACAGTTTGCTTGCTGTCAGGTTTATAT
GAAAGTGCAGCAGTCAGATTCATAGAGATAGAAAG
gtgaaaggtggttgtcaagggctgcgaggaatgaggagttattacttaataggtgcagag
ttttactttaggagaatgaaaaagtcctggagacgggtgaggtgatggctgcacaacagt
gtgaatgtacttaaggccactgaactgtacgccttaaatggttacgatggtaaatctttg

Exon 16 +      39039      39137   0   Internal     99    52    Marginal
gatgataaatcttatgtgtattttaccacaaaatagtatagagagaggctgtctccaatg
agagagtcttctgctgtgtgtgtttctcatcatagtgttacaagctgtgaccttgcttct
gatcaggggaggagtggttcaaatttaaatttggcttttaattctttttttttttttcag
GGTCAGGCTTCTGGGAATGTGGTGAAAGTCGCTCTTGAGAGTTCGCTGGCTGGTTTCGCT
CAGTTGTTAATTGTGGTGGAGGGTCAGTGTGAATACAGA
gtgtgtgtacaggggccacacaggccggtgaagcagggcacccggcacctccctcatggg
actcattttcaaataacagacaccattgctggaggaggacccccctgggctcaccatacc
gtcactgctgccgcacaggctgagatgagaaaccggggcttctagtggtgacatgtttat

Exon 17 +      41783      42078   0   Internal    296    71        Good
ttgctcatcgggtgccacaaaggggaacacaaccacacatggagactgcccataggaagc
acaatactgtccagtcccacggctggtatttatagccagcaaagagctattcagcagacc
ctctgtccattctcttcctgtccttctttttttttttttttctttcctcttgatatatag
ACTAGGCTGATTTTAGATTCTGCTGGAATAAAGTGGCTGTCAGTCAACATCTGGGGGACG
CCGGCATTTCCATCTCGTCTTAAGCTTCCTTGCCAGATGGAAGTCGCTGACACTGAAGAT
GGCACTAGAAGGGAAGGTGGGAACTTGAGGCTCCTTCTGGTCTGTCTGGAGGTGCTGGTC
TCCAAGGAGCGTGGAGGGAGAGTGTGGGAGGAAAGGATTTCACAAGCTTCTGGACTGATC
GACTGCCAACTCTCACTTAAGAGTAAAAGGAAAGAAGTGAATGAGTCATTTCAATG
gtggctgcaggaggtgatcaatgtatgtgcatctataccaacaagcttgtttggcctcca
cgaaggaaaggactgaaattacttttaacaataatacttccttttccgtttgttttccct
tgaagtccgagctgtaataccactctaggtttgaagatactttcagtgttcccagcagag

Exon 18 +      45917      45966   2   Internal     50    71        Good
aagctggagccactgtgtgctccccaggggctgtgtttccacatgcactcttgatatttc
acagaaaggtgaacgtttaagattgaggatggtggaggggggattttcctaggaaaacag
agtagcactctaggcctggaaggaggagaagcagcattagagaacttccttggttactag
TCGTGTCAAGAAACAGAAGTGGTTGGAAGGCATGGTGCACACGGAAGGAA
gtgagccactgcctttctctgaagaccatagcaatcttctgcccatgttttggtggctat
ttttagaatggttgctttgctcttatctcaaaccgagattctgacatgctgttgaacttg
tcagtacctgattggcaatttgattctttagaagaaaaactcagatgtgacccactctgg

Exon 19 +      51381      51507   1   Internal    127    68    Marginal
ggttcgtacaactgaatgtgaccccaatcctgtccccactcagatgggcagctgctaact
ttcatgttgctgtgtggtctttgcagtgtgttctgacgtgctctgtggtttttcatttac
tcaggcggtcgtcattcatttctagatttgcttttgcttttttggctgctctgcgtacag
ACACGGCTCTTTCTGACCAGAAAGAGACCCACACAGAACAGACCAGCGTGGGCACAGCAG
TCAGGGACAGCGTCTTGGCACCCTTGGGGGGCCACAGCAGCGTGAGCAGCCTGGGGGACC
AAGGAGG
gtgccgtccagctgcacccctgcagccagccagtcagctgccccagcctgtgcactggcc
tgtctactgcagcctgcaaggagggcaggcacccagtgtaaaccaccaggcaagttgcag
accagcagtctggagccacttctgggccagatgagttggctcaaggtttcaaacattttt

Exon 20 +      52015      52060   2   Internal     46    73        Good
cggaggtcaggggcagagatagatcactttcctctcttcgggaagggaaaggttttccag
aagtccctacccacagcctttccattgcttcaacatggacagagctgcaggaagacagga
tgtccttcccaaacaaaatcagtgcggctgacatgtcttgtccggttccattatctccag
GCCAGCAGACTTCTCTGCCAACCGCAGACGGCTAGTTGTGCTGAAG
gtgtggggagctcccagctggctacccagctctttgctgggggccaggctcctgcccaac
aaggctcccttcgtgccccactctgctgtatacttggctttgcggcctggctgtaatggg
tgtctgctctggagtgtccttcggcactgataccttagatttcgggattacagcaggaat

Exon 21 +      54958      55032   1   Internal     75    91   Excellent
ttatacaatgtatacatgcattgaagtgtcacactgtagcccataaatatgtagaattat
gtgtcaattatacaaaaaaatcaattaacattttaagaaagaagcctcaggtagaatttt
cttttcatcatatattgagtaaagtagagagatgtcatttctctttttttcttttcccag
GACAAGACATTTCAAAGAAAGTATTAAATTCATTCACGAGTGCCGGCTCCGCGGTGAGAG
CTGCCTTGTACACTG
gtacgtgtgtctcttgcttaatagcgccttagcgtattctggtcggcttggcttcccatc
aagtgtttttccgtgtgtgaataatggtttcacctcctaatagttttctgtaaaccctga
ctctcaaacgcgtgctccatttgtccagcgctgtgtgttagtcgccctttccttctgttg

Exon 22 +      55266      55484   0   Terminal    219    60    Marginal
tcccatcaagtgtttttccgtgtgtgaataatggtttcacctcctaatagttttctgtaa
accctgactctcaaacgcgtgctccatttgtccagcgctgtgtgttagtcgccctttcct
tctgttgaaggagaaccctaactcgttttgcttttgtttttttcccatttccactgctag
GATTTCTGTAGGGACCGTGAAGGTTACTGGACAACAGAAACTTCCCTTTGCTGGCTTGCC
TCCAGCATTTCATCAGAACAGCCTCTTACAGATGACCCAGATTCTGTAGGCTCATCCTTG
AAACCTCAGTGGCTTTTTGAAGACACTGTTGTTTTTTCTTCAGGAGACTTGATTGCAAAT
GTGGATTTTCAGTATCGCGCTACTGTGACACCAGAATGA
cccagtttagtgacggctgtctgtttgcatcctgctatattttgtgtagacacacacaca
cacacacacacacacacagtgaaaagaaagctactgtatcacgcttaacccgaggatgat
gcatctgaagcgcttggcagtgtgcctggcacatagagagttcttagtgaaagtgggatg

Exon 23 +      56399      56709   0    Initial    311    40        Poor
agcggaattctggaactcccactcctgggcttctcctggctcctagtgaaggtgaatctc
cagggttgcagccccagaggatctgtcttttaagatctctcctggtagttctaatctaaa
gccctagtgaagagccactacttgagagtggggttttaaaattattgtttatatttgaat
ATGTGTAGGCCTGATATTCTAGGAATTAATACTTCATACAGTTCTGTGCACCTAAAGATA
GGCTTTTCTAAAAGTGAGACATTTGCTGAACTTCCCCATCTTAACCTGTTGCTAGAACTC
TCTAAGTCTGATGAAGCACAGCCATTCTGTGACCGCCTTCATTTGCATGTACATGTAAAA
CGGGTCTCACTCAGCCTGCTCCAGGTAACTGACCCTAACCGTTACTGCCTGCAAGGGTGC
CTTGCTCCCACCCTGCGGACACAGTGTGCCTGCTCTGTACTCTGCATATTTATGTCAGGA
AGAGTACAAAA
gtaagattgggtaagggcttctctacatcatgggctttaaaaattatagatctagccctc
atatagctgagaaaactcgacttttaaggaacatgaagcattctaaacaaatgtaggtta
taaatgggtttgtcgcgtaggccctggaagcctcgtttccttggagtacctcagttatgt

Exon 24 +      57184      57378   0    Initial    195    97   Excellent
gcgattctagtgccaggaagcatagggagctggtacgttgagtgctgagtggcttcctgg
tggcgagcttgctgtccacatataatccaaggcaggaagactttctgaacaaggtcctta
gagtcccccgctccacatggattgggcgatgaacccggagatctgaaactgccctcacac
ATGTGCTTCTCTTGGCCCCGCAGCCTGGCCGGGGTCTCCAGGAGCGTGACACTGGTGATC
GCATACATCATGACCGTCACTGACTTTGGCTGGGAGGATGCCCTGCACACCGTGCGTGCT
GGGAGATCCTGTGCCAACCCCAACGTGGGCTTCCAGAGACAGCTCCAGGAGTTTGAGAAG
CATGAGGTCCATCAG
gtaagcagttcttaggggacatcagagatgcaggcaggtgcccctgaacggtgcccacag
tctttccgtacacagccagcatcatggcgtttggagttgaaaggcccacagaggacatcg
gctcccagggcgcccagctgcaccccttcagaagtcgtcacgatccctcgtgcacctgtt

Exon 25 +      57771      57835   0    Initial     65    65    Marginal
cttgtgcctggtactccctactagtttgtttctctccctttgggtgacgtaccatttcct
tggtctggcctattttcatgtcctaggccagcaccttgaaggagcagttccttctcttgc
ttgaccctggctggccaaccacagagctctgatttcccactgctgtttgtttccctggtt
ATGTGTGGCACCATCTCTGTGGTGAAGTCACAGGTGCAAGCCCACGTGGATGCAGACGTG
CACAT
gtgtgtgacgtttcgggtttgtttccatcctctccagtatcggcagtggctgaaggaaga
atatggagagagccctttgcaggatgcagaagaagccaaaaacattctgggtaaatataa
ggagcaagggcgcacagagccccagcccggcgccaggcggtggagcagttttccggcact

Exon 26 +      59926      60046   2   Terminal    121    48    Marginal
caatttgccaataaagtacatgtttttcctaagccaaaaataaatacgttaacagaaaaa
tgatttaggatatagcttgaatgcttaaatatgtgcacctttacaaacctctcagtgtat
tcttggagttcttgaaatgttgttttaatatttgttgccagtaatgttctttcttcacag
CCGCTCCGGGAATTCTGAAGTTCTGGGCCTTTCTCAGAAGACTGTAATGTACCTGAAGTT
TCTGAAATATTGCAAACCCACAGAGTTTAGGCTGGTGCTGCCAAAAAGAAAAGCAACATA
G
agtttaagtatccagtagtgatttgtaaacttgtttttcatttgaagctgaatatatacg
tagtcatgtttatgttgagaactaaggatattctttagcaagagaaaatattttcccctt
atccccactgctgtggaggtttctgtacctcgcttggatgcctgtaaggatcccgggagc

--------------------------------------------------------------------------------