--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (142567 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (24 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1309       1364   0    Initial     56    55    Marginal
ggcgggaacgcggaaggggctggggttgcggcgcggcggcgaggaccagaccgggggcgg
ggccggtagtgggagtgcggggcgcgcggtgacagcgcggggttggcggcgtgggaccca
gggggcgacagaggcagcagcagcccgaggcctgaggagaggagaccggcggcggcggca
ATGCTGGAGACCCTTCGCGAGCGGCTGCTGAGCGTGCAGCAGGATTTCACCTCCGG
gtgggtatacggtgggcgacgaaaagggacctgagggggccgggccgccgcctgggatgc
ccctgcctcgctcccttccccgcgccacggtccagggtccgtcctgtcccgcacctcccc
gccccgccccgccgaggaaagtaacgaacttcccggcgtcctcgcgtcgggcggcgcaaa

Exon  2 +       8595       8700   2   Internal    106    61    Marginal
atcttttatatttttcatcttaagaataatagttggaaacaatcaagaaagtttagcagg
caaaaagatgactattttcaactttcctatggctactttgtttttttacttttttttttt
tttaacttcgttttactttcctatagctactttgttttttactttgtttttattttttag
CAGGGAAAAAGATGACTATTTCCAACTTTCCTATAGCTACTTTGTTTTCTCCAACAGTTT
CTTTTCTGCATTTTGGCACATTGGCCATTTATTTGGAGAAGAAGTG
gtgagaaaagatgaatacctaaaagattgtttttgttattaaaaatgttttttggctgga
tatggtggttcatgcttctaatcccagcacttggggaggctgaggtgggaggatagcttg
agcccatgagttcaagaccagcctgggcaacatagggagacccctgtctctacaaagggt

Exon  3 +      12038      12091   2   Internal     54    91   Excellent
atagtcccagctactcaggaggatgaggtgggaggatcacttgggcccaggattgaggct
gcagtgagtaatgtacatgtcactgcactccagcctggacgacagagtgagaccctgtct
caaaaaaataataataatctcttgacttgtaaaaatattatattttatattgaattatag
GCTGAAGACTTTAAGTGACAAGTCAAGAGAAGCAAAAGTGAAAAGCAAACCCAG
gtaagcttgtgctaagattttaacttaactgtgacttaaatttcatacaacttttggtgt
attcacaattgtgtagttatattaatgaaccttagatttgttgagtgcatctgactacaa
aataatttatcgattctttctaaattttgtaacaggaaaattttctaataaaatcgtgaa

Exon  4 +      24422      24458   2   Internal     37    58    Marginal
aatggtgagatgttaggaaaagtgatctggagtctaaatttggcaagtgaggattaattt
tctctttcccactgagttaagaaaatgatagaaaattttaccacgaagtcctgaattttc
aatttataattagtctatttcctcactcaacagacatttaatgtgtctcttgtttgttag
GTTCTGTGCTAACTACCAGGATAACAAAGATGCAAAA
gtaaaatttatatctcagcagttctggtgcctaacagtgcttagcatttagtaaatactt
gttgattttaattgatgcttacataatctgatacatccaagaaaattttctagctttctg
ttagtcaacaatgacagcaggactgtattatttgtgtgaccttccaccttaattttcatc

Exon  5 +      28291      28401   0     Single    111    62    Marginal
tccacagattaaatcaggctccctgtcctcaaaatgttagcaatcacacaagtaaaccac
caaaagtttgagtcaccagaaccaaagtgtgagatttagacccataaaggactgtagata
ctgcactattgaatattgactgttaaatagttatatataaaatctttcaagagataaaag
ATGGACTTAAACGTGAGTAAGGAAGAAGGCACTATCAAATATTTTAAAGTCATTGAAATT
ACAAACCCAAAAGATGTGCTTAACAGCAATTTGAGGCAGCTGAAGAAATAG
tgaggtacaagagagagtcaaagagtacacagaaaggatctcagaaagaaaatggaaaat
atgaaagaagaattgataggcagagaatacttataaaaggtctttaggttgaaccaggtg
agattgccaatattcgatgaatttttatctgtaaaattgcagtttcatatgagttagccc

Exon  6 +      29891      29931   1   Terminal     41    64    Marginal
gcaggcacctgtaattccagctacttgggaggctgagacaggagaatcacttgaacctgg
gaggcagaggttgtaatgagctgagattgagccaccgcactctaggctgggtaacagagc
aagactctgtttatcttctaaactagtagaaaaaaactagaacaatgagaaagaattcag
TCAATGCAAAAGATGACAAGAAACCAGAGGAAAATGCATAA
cagtagaataaacagaataagatggtaaatgtgaatatatctgcagcctcaatattttta
aatgattaatctagattaatctaaagggcatattttgaaagacgaggaaaagtctattaa
tagtttataagttactgacaagagaaacacctagaacataggacacagaaagattgaatg

Exon  7 +      36703      36870   0   Terminal    168   100   Excellent
ctgaatattaagttgtttcttttctaaaaatgaaaacaacttcagtctcttttagaatgt
accgtaatctctactgagtagaggggttgttaaagataacattaaatctcattacgttaa
ctgtactttctttgtgcctaaaacctggtttcactttaccccccttcttgtgtgctgcag
CTGGTGGATAGCGAGGTGGTCATGCTTTCTGCGCACTGGGAGAAGAAAAAGACAAGCCTC
GTGGAGCTGCAAGAGCAGCTCCAGCAGCTCCCAGCTTTAATCGCAGACTTAGAATCCATG
ACAGCAAATCTGAGTAAGTCCAATGTTTTCATTGTACATTACTTTTAG
gaatgaaaacaacttgggcagggtttggtgtaatttcagagcttttcaggaacacatgaa
attctgggttaacaggattttttggaaaatcatgatttcatattttgattagttgaggat
tccacagaaaatgatgtaaagtgtagaaattagttctgtttctgcctcaggtcagctccg

Exon  8 +      39132      39229   0    Initial     98    69    Marginal
tatctgttagcctttgaaatacatgcttcctttgggttttaatctattgctgttatttgc
ctgatatttataattagtaatgaatgactgtggaagatagcatatcaaaacttggaattt
tagagacctagttagtatttgttggcctagaataagcccagagagagttgttttaaaatc
ATGAGGCTTTTAGCTAAGCAATTTAAGCTTTATAGAATCATTGCTGACGATATTCTTTAC
AGTAGGAAAACAAACACTTTGAAGCCAAATTTGATGGA
gtgagttgtgtaaacatgtatctgtaccattaatgtactttatgaattcattttgatgca
tttatgtatcagtcttagattttggaaacatttagtgttttaaatgcttactcatttact
gggtttttttttttggaagcctcaaaatctctcctattattacccaaataccttgacata

Exon  9 +      42191      42229   0    Initial     39    52    Marginal
ttaaactagatgaccatgaatagttttgccttctcagttattttacatgttagagtaata
aaatcattctatcaccagaaattattctttattgaattcaacagacagggttattagggg
atagcaaaaaagcaaaaatacagtctgcacctttaaggcccttactgattcctgagagat
ATGAGAGTACACAACTGGTTGGATGATATCAGTCAGAAT
gtgagtcctgtgtgaggctgaaaggtctggggaagcacagaagaggaagggagccctgtg
ggaggagggcgggctgccactggcctaagcctgaaaagacaggccggggttagggacagg
cagaggcaaggaggaggaggcaccaacgctcagtactcctcttgttttgctgtaatgtag

Exon 10 +      43103      43145   2   Terminal     43    51    Marginal
tccagcatagaataattgttggctccattacatagtttcttttcagaaaaatcatttgaa
atttaattccttttacctgtaggagatcttaagtctaagactatagcctggaaaataact
tataggtgtgtaagtttgtaagataaaaatgaaaatgttgttgacattttgatctaatag
ATCCATAGATCTTGTTTACATCATGATCATTACTGGTCAATGA
aattattagttttcaatcacttttattaaatataaaacttagctaatctaaaaattttct
ctattttttatattcaaacattaattatttactgtcaagtattaagtttaggtacttcgg
ctcatttaatccttttaacagctttgcaagatatgtgttgttagctctctcttcacagac

Exon 11 +      48779      48911   1   Internal    133    99   Excellent
ttgaattatggtttaatgttggccagtatattttattttgcttcaagaaagtttaataaa
aaacattaaaaatgcaaaacaatctcaacaatgtgaacttttacctttttgatacttttt
gtattcatcatgattgaggattctgacttttgaggtctgtttatttttatatactttcag
CTCATTTAGAGGCGAGTTTTGAGGAGGTAGAGAACAACCTGCTGCATCTGGAAGACTTAT
GTGGGCAGTGTGAATTAGAAAGATGCAAACATATGCAGTCCCAGCAACTGGAGAATTACA
AGAAAAATAAGAG
gtgagtttgaaaagtttgccacagtattcattccagtctcgaagttttccatattacttt
acatgctactctttagaagtcccggctgataaaagacaaaggtttcaacataaaactgat
aaataagctttccaaaactttttttaaaaaccactgtctgttgccatcttttggagatga

Exon 12 +      55485      55663   0   Internal    179    58    Marginal
aatttcactacactaggaataaagatcataaaagccttcaaaaaaggcttttatattaag
gatcaggaatcaaaaggaacatcaacttttcagcaacaatgccgaaagtagaaaatggtt
actaagaatatttactgggcaaaattttcatcaagcatgaggaaataaagtcatttccag
GCAGCCAAGGGCTCCAGTGTGGTGGATGTGGACACTTTGTCAGGAAGCTCCTGGAGGATG
TGCTCCACACACAAGGGAGTAACCCAGGAGGAGGAAGAGCCTGCACAGAGCAGAGATGAG
TCACTCCAGGAGGATTCATTCTGTTCAGAAGAGACACCAAGGGAATTTCTAGGGAGGTG
gtgagaagcttcagcaatcctagagagcaattcatattgggacaggaaggccttctggag
aattctaagtagtgtttccaagggggaaaaaatgaagctaatgcattgtcttatcggcgt
ggcaatattgagaggagctttatgactcctttatttatttatttatttatttataacttg

Exon 13 +      59678      59809   0     Single    132    44    Marginal
agagattatggcgtatctgtagtggcgtttgaccagtgtatgttctagagactaacttgc
caaattcctgagcttcaagaaatgagtgttcaagctcacctgccaagagactggcaagct
ggggagaaggggaggtgtggcaggagtgtggccctcaggcctggctttgcggagctgaga
ATGGGAGAGAAGAAACCAACAGCATTCTCCAGGGTAAAGATCCAAAAACGATCTCTTTTG
GTTCTTCTGGAACCAAAAGAGAAGATCGAGAGCACCTTCTCTGAAGGAGCCAAGCAGCAG
GGCAGTAACTAG
cttctgcagttctgcagcagaagtctgtttggatgctgaatgaaaaggggagcaggagaa
cttttccgcaggcaatgactttacaaaaagggagcagacttctgcatccaccaggatgga
gtaacagggaccagatttattctctcccccgaaacaatgaaaaaccaggtgaaataaatg

Exon 14 +      63943      64047   2   Internal    105    58    Marginal
aaactccaaattaactcatggaagtctcacaatgaccatttgagtaggtgtactctcttc
tctaccaataagaaaagagagactaggggagataaaacaacttgtcaggagttggaagta
gcggtgctgggccagaaccaatgttttcctgacttcaaagtctcctcatatctttgatag
TAAACTGCCTCCACACAAAGCCATCTGTACTCTGTGCTTGGGTGCCATGGAGTATGGAAA
GGACCTTGCTTCTCTGCGTGTATGGACTGCTGTGGGTGACTCAAT
gtaaggatggattgagattttagggcctggtgccgcttgatcaggaatatatttgtatgt
gggatgcatgagtttaaaaaaaaaaaatccaccttctaccctatcagctataaatggcaa
caagcctgtaaggatatacagtttcaagtggtggggcatgactgcagacagctaataaat

Exon 15 +      68328      68451   0   Internal    124    87        Good
ctgtgtactcactgcttttattctctcccttgccagtatatccatccatcacagctagaa
cgttcttcctaaaatacagctttgctcatgttattctcctgctaaaaataaaacaaaata
ttttagcctggcactgagaactctctacctttttatctgaattactttctcttcattcag
CCTGCTGTTCTGAAGTATTTGCTCCAGGACAAGTACTTGCTGAAGTATTGCTGTTCTGAA
GTCTGTTTCCTAAATATAACCTGCGTCGTCTTTGGCCTCTGTGACCTCACAGTCACTGCT
GCCT
gtgactgacatgcctttccctgccttctcttacattttctatatttccaaatgctgagta
cctctaacagatggtggagtacaccctaacaattgtgaaatttcaaggctttcagtgctg
ctgctttacctcatcagttccttaaaagttccataatactggttgggcacgatgactcat

Exon 16 +      93471      93578   0   Terminal    108    62    Marginal
attttctaagtatgtggttttgaattggtctttattttcctgttgtctagttagcatacc
accttagtttacattcaaatattattcaaatattattttttatcaaaaacttttaccccc
tttaagtgaaaatttacaaaaagctgtgagtataattagcttatttttaagcactcccag
GAAGAACAGAGTACTGTAAACAAAAATTATCGGAAAAGAAATTTGAAGGAAAGTGACTTT
ATTGCAGTGAACAGTTTGCAGTACAGGGAGACACAGCCTTTGGTGTAA
aacgaaggtggggtttgggttttataacaaaagtttcaccctggttcccagccaggttta
tttatgcaaatgcaggattcaaacttgcttagttccagctggttgatatagctgagttct
gatgggttcgttcaggtgacctctgaaagtttcaaagttgaacagaggtgtgggcttttg

Exon 17 +     104875     104985   0     Single    111    66    Marginal
tcaccggttgttgcataaaatctacttttcatcacacatcacagtctgattgagaaatgg
tttgttgttgttgtgtaggataaaacaagatgacacttcaaaatgacaatttttttgatt
ttcactcagctcataaggcacccacttaccatgcttttttacccttccaatttgcttcaa
ATGCTGAATGACCACAGAATGGTTGATGTTGAGCTCTTTGGCAACTTCTCGTGTAGTTGT
AAGAGGATCAGCCTTGACGATCGCTTTCAACTGGTCGTTGTCAACTTCTGA
tggctggccaccgtgctcctcatcttcaaggctcttgtctcctttgcaaaacttcttgaa
ccaccattgcactgtcagttcattagcagttcctgcgccaaatgcattgtggatgttgcg
agttgtctccactgctttatgacccatttcgaactttgatacgaaaatcgctcaaatttg

Exon 18 +     111824     111918   1   Internal     95    64    Marginal
attacaggaatgaaccactgcacccagctgtgctgtcatactaattgggtacatgtaagg
gaatcctgtaatatcttggatgtgttaaacctttcattgaataaataatatcagcttata
ggttgtgtgctattctaaataaaccctcaatattccttcagcttctctgcctactttcag
GTGTGGTCAACCCCAAAGAAAGGTTCATGGCATCATTTTGTGAGTATGAATTTGGGGGAG
GAGTTCAGAGGGTGTATTTTATTGATCATTTGGAT
gtgatttatttttggcatgctatttttaatgcattacagatttcctggccagcttttcca
tagcccttgggtaacgtcactttttattgaactgaatcttaagtgcaggtgtttttggat
acctcctgcactgattccatggaccagtctgatgtcattgtccgttgcctgttcctgaga

Exon 19 +     130783     130980   1   Internal    198   100   Excellent
aggaagtgcagcagattgggggacaaggaggccagctgtacacgcagtcggggcaccagc
ccagtctgtaaacgcggcatgactccatccacttggagggtggatgcgagcagctgttta
tacccatttcctctctcagtcccttttcaaaccctaaccccagttattctgtttcctcag
CTGAACTAGATGCAGAGCACGCCCAGAAGGTCCTGGAAATGGAGCACACCCAGCAAATGA
AGCTGAAGGAGCGGCAGAAGTTTTTTGAGGAAGCCTTCCAGCAGGACATGGAGCAGTACC
TGTCCACTGGCTACCTGCAGATTGCAGAGCGGCGAGGCGAGTGGGGGCTGGGGCTGCTGG
TGTGGGGACTCACCGGCT
gtgcggggtggcgatggacccctctccccagagcagggcatggggcagaatcctcagaag
ttccgttctgttatgagaccccagcaaccaaaatgtgtgcgtcgggccacctctctcttg
ccctgcttttgcctcttctatcagtctaagctttagttgaagatatattttttttaatac

Exon 20 +     135621     135793   1   Internal    173    66    Marginal
tttcatttcactagatgctgtcaaatttcttgccaaaacatttgcaccagtttatagtct
cctcagccacatatgcacattctgattacatcttcgccggcacttggtagcatcagattt
ttaaatttttgctaatctgttggaatgaaacgacacctttggcagtttctgtatattcag
GAATCTTCAAGCCTCTCTTTTCGGCTCCATTCTTCTGCCGCCCGTCCCTGAGCCAAAACC
ATACTGTAGTCTACTTAGTCATCAAGTGTTGGTTCTCAGCTGGGGACACTTTTGCCCCCA
AGGGGACATTTGGCAATGTCTGGAGACCCATTTTGGTTGTCGTGCCTGGGGTG
gtaagggtgtgctattggcatctagtgggcagaggccagggatgcagttaaacaccccac
actacccaggacaccccacaaccaagaacgatctggcacaaagtgtcaggagtgctggag
ctgagaaaatgttttctagtgaagcttgagtctgctggagccattcctgacctgctctgc

Exon 21 +     137534     137658   1   Terminal    125    56    Marginal
tctcctgcccttttcaagaagatggcacagacaaactttcaaaactgaagtcagaagcca
cgatctaaaagacaggccttggcgaaaggcttccgtaggtcagaaaggaaaccctcagaa
gcgtgcccccaaaaagaacaagcctgaccagcgtgccttcaaattcccctgaccactcag
CCTTGAAGATCCAGCCCAGCGAACTGCTGTCCCTGTGCGGCTGGGCTCAACCCCCGGCCA
AGTCCGAGGCAGAGCAGGCTGGCTCAGTTGGCGAGGGTGATGCCGCCAAGCATGGGATCA
TCTAA
accataatacttttccccaactaaaaataggaattactcttacctctcattcaagtgctg
aactttagtgattttctgagcctgaggataatgagactcactttcctcccagatgaagcc
gcaatctcacgtcgctgtggctctaagcaccctcctctccacccccgtgtctttgttcag

Exon 22 +     139523     139652   0    Initial    130   100   Excellent
tttaaagtgccagactggcatatgtcatctactaatacgttgcttcaaattccattttga
aggaagcttaggaaatgcaatgtagttagcctaatgccaatggaagttcaccttttaaag
taatattaaagacagcgtgtcctttctcgtgttgatctatccgcagagcccataggcagc
ATGTCATCCATGGAAGTGAACGTGGACATGCTGGAGCAGATGGACCTGATGGACATATCG
GACCAGGAGGCCCTGGACGTCTTCCTGAACTCTGGAGGAGAAGAGAACACTGTGCTGTCC
CCCGCCTTAG
gtagggttgacaaacttgcattagctgaaccagggcagtatcgatgccactcccctccaa
aggtgagacgtgagaaccatctgccagtcacttacgcataaacccccaagctcacagcca
gctcctggctccctaaccccacggttccacacggctgtgtggcagctgcaacagtggtgt

Exon 23 +     139934     140073   1   Internal    140    55    Marginal
acccccaagctcacagccagctcctggctccctaaccccacggttccacacggctgtgtg
gcagctgcaacagtggtgtggttccgtcatgaattcttctcaaagatttgacatgctcca
ctccggtaactttggtgagttgagagctttcttgtttgttttccctcctttaccacccag
AAATCCATTTGAGTCTGCTCCTTGTGGTTAAGGACTGGCGTTTGCAGGGAGGTGCGGACT
CTCCTGCGGGGCTCACGGGAAACTCTTCCCTCTTCGTGCGACAGGCATTTAGGGGCGTGC
CTGCCATGGGCAAAGCCATG
gtgtgtgttcagctcttggcctgtgttgtaaacttagttgcacttcagttcctttcatcc
cttcacaaaattttgtttcacattcatgcagcaaatatgggctgaggtgccagacctgta
cctgggcttggtgcgtttcaaatttcagaccagttctttgggctgggtcaaggcaaagct

Exon 24 +     141000     141203   0   Terminal    204    96   Excellent
caagttctgcaggccccaggtgcctggaacaaaaaccacacccccctttcatgacgggca
cattccacagctgttggcggcaattctgattcacaatatttttatgacagggctttttct
tccctacgttattttgcagggcctgaatccagtacctgtcagaatgagattaccctccag
GTTCCAAATCCCTCAGAATTAAGAGCCAAGCCACCTTCTTCTTCCTCCACCTGCACCGAC
TCGGCCACCCGGGACATCAGTGAGGGTGGGGAGTCCCCCGTTGTTCAGTCCGATGAGGAG
GAAGTTCAGGTGGACACTGCCCTGGCCACATCACACACTGACAGAGAGGCCACTCCGGAT
GGTGGTGAGGACAGCGACTCTTAA
attgggacatgggcgttgtctggccacactggaatccagttttggctgtatgcggaattc
cacctggaaagccaggttgttttatagaggttcttgatttttacataattgccaataatg
tgtgagaaacttaaagaacagctaacaataaagtgtgaggacggtaaactgagagcgcac

--------------------------------------------------------------------------------