--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (24999 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4142       4197   2   Internal     56    66    Marginal
aaaacccaccaaaatttggaatagaacctcttacttccctctttccaaacaaaaaatgat
tgttgaaccctaggagcatttggggggaagaactagagaatgtttgttgaggaaaatggg
taaattttcaacttactaatttcaacttataacaatatattcctttatttttaaaaacag
GTCGTGGTGGGTCAAAAATAAAGAATATACAAAGTACAACAAACACCACAATCCAA
gtaagccatctgtgtttttcggcccttaagagagcatcatgcatttctaagggagcacct
aactctacttttctttttaagacagcctcattctgtctcccaggctggagtgcagtgacg
tgatatcagtacaacctctgcctcctgggttcaagcaattctcctgcttcagcctcctga

Exon  2 +       6738       6816   0    Initial     79   100   Excellent
actgtatttactttatactgtaatagattttgaagttgagtgattgttggaaggggttag
gggcttagggaactttttatgttttttagggaaattttaagtctcacctctttttcccct
tgtacctagataatacaagaacaaccagaatcattagtcaaaatttttggcagcaaggca
ATGCAAACGAAAGCAAAAGCAGTGATAGACAATTTTGTTAAAAAGCTAGAAGAAAATTAC
AATTCAGAATGCGGAATTG
gtaagtaattttctcccactgaacccctttaaaagtttttaatttcattcagtgttataa
gccattatacctgatttcactttctgattcaaagcattaggctgccataaatgcagtctt
aatgattttttactatgaatgaaagcccagaatatttttcctcaaattaaaataccagag

Exon  3 +       8299       8443   0    Initial    145    45    Marginal
gcggcgtgtgcctgtactcccagctgctggggaggctgaggcaagagaatggcgggaacc
cgggaggtggagcttgcagtgagccgagatcgcgccactgcactccagcctgggggacag
agcgagactccatctcaaaaaaaaaaaaaaaaaaaaatagaaaaaaactaatcgatacaa
ATGTTTTTAACAGATACTGCATTCCAACCTTCTGTTGGAAAAGATGGAAGCACAGATAAC
AATGTTGTTGCAGGAGATCGGCCATTGATAGATTGGGATCAAATTAGAGAGGAAGGTTTG
AAATGGCAAAAAACAAAGTGGGCAG
gtcagtgctgcttcctaatatttacatatattgtttctgttaactgcagtttttattctc
tgtacaatgtctgtgctttatttttagtaatgaaatgtatatgaaaatagtaaaatctaa
aatgctgcaattagtccctaggttatgatagtttctatgttatcagctgtcatttatgct

Exon  4 +      15701      15817   0   Terminal    117   100   Excellent
gtagacagtgtacaatgacaaattgcttagtattctgacctctggagaaattagaatcgt
ggcttaagtaataggggaaatgagaaaagcctttcttagtgttctactaataaagaaagc
atatgtattattacctgcctcccatatctaatctaaccacattcttttttgtcaatgcag
GTTTTAGATGAAGCAGACAAGATGTTGGACATGGGATTTGAACCCCAGATAATGAAGATT
TTGTTAGATGTGCGCCCAGATAGGCAGACAGTTATGACCAGGTACGTATATGCTTAA
ttactgtgtgcagaatagaaatcagtggaatagaatctcattctgtttggattttcccac
aatatttgagcattacttggaagtgttgaaatctttaggtgaaagatctcataacattgg
aagtagaacagtgtaacaataagtgcttattcatgactattgggtttcctaagttacaga

Exon  5 +      21001      21139   1   Internal    139    97   Excellent
tgctgaaccatggtatcttgtaacttgccggcagttacttttccattttcacaaagtaag
cattttaatgtaaacagtaagaaataaaattgattaaattagttagggcaaatattattt
ttagatcttgggttggtttataccagaatggttcagtgttcatttggctttactttttag
GCAAAGTGAGAATACTAATTGCAACTGATCTAGCCTCTAGAGGACTTGATGTCCATGACG
TTACACATGTCTATAATTTTGACTTTCCACGGAATATTGAAGAATACGTACACCGAATAG
GGCGCACGGGAAGAGCAGG
gtaagtaagcttagtccacccatgaaaggccaattctagattctccttattcctctcaca
aacttcttgcccagaaaaccattttattctattacctataatttttcagctacttcccag
attatacttgctactttatttatccctgttcatttggcttgttccagactcaaccagatt

--------------------------------------------------------------------------------