--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (114254 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (39 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3933       3961   1   Terminal     29    59    Marginal
gaatgttataagacccttcataaagggagtgctgtatttttatttttcagtttttcagcc
atcacaagccagtattgcttggaaagaacctctccccaaatctagctacatattttccat
gattgaaggctagtgggtggagtttctagggctctgatcatccttacttccttcctctag
AAAAGGTGACCAATGAAGATATTCCATGA
gcatccctggtccattatcctgaagtgtgggagaagaaaccagggatcctggatgtctgg
cctagaaatcactcttgtgtttgtgctctttagggagggagaaggacagaagagcaggtt
gtataagtatggtggggaggggaaaggtagggaggtgggggtagggcaggagggtcaagg

Exon  2 +       4676       4693   0    Initial     18    47    Marginal
tggcctgggatgacttttaagcttttaagaggctcaaccagtggtcaacttctcttgaga
tggcccagagcgggggtcagtgaattcctcactcttggcagcatctatttctccaactct
ctccacattttttggtttgttttttgtttcattatgaggttctaaaactgcacagtcaag
ATGCTGTGGGGGGAGGAA
gtaagtgcctgttcttggaacctgtgcagcgttatgctagcactggccaagacttatcag
actatggttattaataggtgttatgggtttctttctggggtccccctccaaaaaaaaaaa
aaaaaaaaaaacctgtaaaaaaaaaatgaactttaggcagtttgatgtctctttcaatcc

Exon  3 +       5245       5403   0     Single    159    40        Poor
ggaatgatataagggaagaagctagcaaactgctcagtaaaatgttaatgccattcccct
ctccagttctaagtccgtgaaaatacatgggtttagacatttgtccacaggtcaaagtaa
ataagccacttattcaaggattaacaactgtgcttggaggtcagatatctcagcctggag
ATGGAGACCCTTTATACAAAAGTGGGGCACAGAACAGTGCTCCCCATGCCAAGCAAATGG
CAGCCCCATGTGACCCTCTATTGGAATAAAGGAAAGGCCACTAGCTCACTCACCCATGAA
TTTGGGCTATTTAGTGAGCTCTCCATAGAGCTTGTTTAA
aaagctcaaatactgtcctgagaatcaaggtcaaactgaggacagaaatcattgaggcag
tacctaacattaaaatctaataatgatgtcacaatgacagcagtattttaaatttatata
acattgtatcatttgaaaggtacattgtctcatttaaacatcgttgacaatcatatgaga

Exon  4 +      27316      27407   0    Initial     92    46    Marginal
tgtgcctttgttccacaccctttttcagtgatgccagtgccagggggtacagcctcaggg
atgtataacagggttttcctccacaaaactggcagaattgttctgggttcttatttgaaa
atgtggcatgtggcctctcatcagtgctttggccattttgcatgcactaactcacagaga
ATGCAGGCTACACCCCAGCTGGTGAGCATCACCATCATCTCTATGCCCACTGGCTTTCTG
TTTGGCTGGAGGGAAGCTGAGGACAAGAGGAT
gttaggttggagcacagggaggcctgtggaaggcagggacggtgtagagtctggcccagc
tgaaaatgggcttggggagcctggccagtccttcaggtccatctgggcaaacctagtctt
caaagggcagagtcacaaggacctcaaatgctacttacctcctccagtactaacatttga

Exon  5 +      29188      29243   2   Internal     56    91   Excellent
gttcctattgggactaaatcattttcttcatgcaaagcacttaggaaagtgctgtgtaca
tagcaaataattaatatttcttatgggttattgcaacaccctctgggtgagttcagccct
agaggaaagtaggtgagttcccttggggaagggtctttctgcctccatgttctacatcag
GAAAGTGGAGAAGCTTGTCATACCACAGGATGAGGCTAGTGCCGAGTCACAGACTG
gtgtgtgttcagagtttttccctggaggatgctagcttatcctcccttgctccttccttt
ctagcatttccacccacctcgggctcttggggcaggctgtccctttaagaaagagagcca
cacattctgctcctgacagtggccctgcctcccttgctagataccttgctgggctgtggt

Exon  6 +      32886      33031   0    Initial    146    65    Marginal
aaggccaggcccctgccagctcctgggctcccatgttagcattttcagttaattaagaaa
acaaaccccacatccttgacagaggtggttctgccaattcaggacagagaactttgcatc
agcatagcatgcaggagaagctggccagctcctgcaggcaggacaagctgagggaggcag
ATGTTTGAGCTGGAGAGGACCCACTGGTGCCTTCTCGGCAAGAGCAGGTTCCGCGGAAGT
CGCATGGTTGGGAAGCCAGCTCCAGGCAAGGTCCAGAGCATGGAATTTCTGTTCCTCTTT
CCCCATCCAGGGTGCATTTATCATGG
gtgagggccatggggaaaggccagctggatgagaatagcagggggagacacaaatacttt
cttgggacttgccagtcttcctctccagagccaggttatcccaactgtctaactcctgga
ggagaatgatgagaggtgacctggggtggcttcagaggggcccaggtagctgacctgcca

Exon  7 +      36421      36475   0    Initial     55    55    Marginal
ccctgatgaagcactgagcacaatgtttgaaaaccactgttctgtctgactctcgctaga
ctattagcttccagaatgcaaagccctgactggttcagttttgcatttctagtatgtctt
agtccatttgtgccaatattccacacactgggtaatttataaaccaaaacaacatttctc
ATGGTTCTGGACTTTGGGAAGTGCAAGATCAAGGTGCCAGCAGAGTTGTTGTCTG
gtgagggctgccctctgctcctaaggtggtgttttgttgcttcttaatgaaaaactgtaa
agagcataggtactccttgcatttttgctattcattcatgcagccaatatttaataagga
cctactatgcattagcccttgccagtggaactatgctatagtttgcatgtctgtgttcct

Exon  8 +      37570      37673   2   Internal    104    66    Marginal
gggagcgggctgtgtgttccacacagggtgtgtggatgggcctgcacatgcgcctatgac
tggttgtgggtagcaagcacagaatgatcctgtttttctgtaaatactgagccacaaaca
ttggcagtgactttctggccattatcctcagtggtgtgtgattcttgcggcttttcccag
GGTGTACCAAAGGAGTGTGACTGTGGTGACCATCGATGGGGAGGCTGGCAGCACTCAGGG
TGATGGACAGAACCCCATGGTTGGTTCCCTCTTAAGAGGCTTGT
gttggaggctgagtgatacctcatttggcaccagttggagagtttatagcctgtgagggt
tcttacacttaccaagaggaaattgggcaatagaaatttatgttaatgtctgtgggataa
caaaaaagcaacatgtccctgggtcagtagtgatcttaccttcaggggtttgtttattca

Exon  9 +      61011      61046   0   Internal     36    79        Good
cttcctgtactcctcactgaaacccagcgaggaagaccctgtgatcagggtgtcacggat
gaggaagctggggcttcagaggtgaagagtactcatgggcactagctgagaacacaaagg
tgggggaatcccagtctcctgacttcaaagcctctgctccctaccccaccctgctactag
GAAGCTGGAGTGAAAGAGGTGTCAGAGCAGGAGCGG
gtgaggaattagggttcagatgatggaagcagctcctactgatgaggagaaggaggcagc
atttggagcctctataaacctctcctgctctctagagggatttctaaactaagctataga
gattgatctgctctagcggagggaggctatggctatgggggagctgaaggcaaggtaaga

Exon 10 +      64430      64653   1   Internal    224   100   Excellent
agctggagggaacagagggatgctgtgggaggaggggcgacagcggggtgggtggggctt
tgctattgggttgagggctcccagcaacctgtgggacagaggttatgaaggcagagtgac
ctctgccctggcctatctgactgtatgcctgaccaccctgtgttctctcctcttgtccag
ATCACAATGAGGACCTAGGGCATCTGTCTGCTGACGCCCCCTGGCCTGCAGTGACCATGG
CCCCCCGCAAGAGGAGCCACCATGGCCTGGGCTTCCTGTGCTGCTTCGGGGGCAGTGACA
TCCCCGAAATCAACCTCCGGGACAACCACCCTCTGCAGTTCATGGAGTTCTCCAGCCCCA
TCCCGAACGCAGAGGAGCTCAACATCCGCTTTGCAGAGCTGGTG
gtcagtgagagggtggggagagacagtgacaatggggaggagggtggatggagaggcaga
gctggacagagggcagggcccctgtgctggggtctccatctctcaaaactcctcttggga
ggagataggcccccaggacacctcagctatgttggggaaccagagtctctcactgggatg

Exon 11 +      69111      69200   0   Internal     90    93   Excellent
gatggggctgtatctctgatagaaaaagaaatgccctatcatatctttgatgctcttcgg
gaggaagatagtagtagcctgaggaactgatttgggggaattgtaatttcctgcagggct
gactattctaatctcaaccatccctagtgtcagacgtattttttcttattgtctttgcag
GATGAATTGGATCTCACTGACAAAAACCGAGAGGCTATGTTTGCACTGCCCCCTGAGAAG
AAATGGCAGATCTACTGCAGCAAGAAGAAG
gtgccctctctgacccctctggccacatctcagggttcatggcatggggtggctcttgct
gccttggcatgctcatgcattcacctgatgtttattacatgccagccctgttctaggtgt
tggaggaacaacagtgaataaaatagaaaaaggaaattctgctgtcctggagcttacact

Exon 12 +      72616      72690   0   Internal     75   100   Excellent
tcatctgtatttcaccaagggagaaatggaagcctgggggagagtgtaatttcctccaac
ccacccgacatgggcagagctgagaaatgaatccctctgctgacacggaatgaagctcag
gatctcaggccacgggcctgtcttgcctgttggtccatgctgtcctttttcttgtttcag
GAGCAGGAGGACCCCAACAAGCTGGCAACCAGCTGGCCTGACTATTACATCGACCGCATC
AATTCCATGGCTGCG
gtgagtggctgcccctctcctgccctgcccccacctggaaaggctacggcagggagtgat
tcccccagcccccaccccccacacaccaaactgccttttactgctcctcagcgccccact
gcccactcactggagttcagcagctttccagttattcatgaaattttaaggtaatccacc

Exon 13 +      73163      73257   0   Internal     95   100   Excellent
atgaggaaagtgaagtcccagcccagaacctaggtcttcccaggggccgacactcggtct
cagtaaaccattccctgaggcctcaccctttctgaggcaagcatggcccctgggtcacac
ctgagctgtagtgcagagggttgggagacaggcagcccctttctacctgctggccctcag
ATGCAGAGTCTGTACGCGTTTGATGAGGAGGAGACGGAGATGAGGAACCAAGTCGTGGAA
GACCTGAAGACAGCCCTCCGGACACAGCCTATGAG
gtaattcagtttccccctcttgcttcctgctgagtcccttcacagttggtctccttgcct
tcccgaagccctgtgcagtgctctgctcccatgccggtcctcctggccaactctgcctca
cctgacttcacttcccagcccctactcctctcctgggaggctgccagggcttgggaggag

Exon 14 +      75693      76026   2   Internal    334    97   Excellent
gacacaagtcttttgtgaagatgataggatttcactgctttagataaactacgaataaac
caagtggctactgtaggtgggacaaggtgcatggtggtacacaggtaagggggtaactat
ttgcaaagtgtacacagaatcatatgcaaatatatgtttgttaatggctctgatttgtag
GTTTGTGACCCGCTTCATTGAGCTGGAGGGCTTGACCTGTCTGCTAAATTTCCTCCGGAG
CATGGACCACGCCACCTGTGAGAGCCGCATCCACACCTCACTCATTGGCTGCATCAAAGC
ATTGATGAACAACTCCCAGGGGCGGGCACATGTGCTGGCACAGCCTGAGGCCATTAGTAC
CATAGCCCAGAGCCTACGCACAGAGAACAGCAAGACCAAGGTGGCTGTGCTGGAGATCCT
GGGTGCTGTGTGCCTCGTGCCTGGTGGCCACAAGAAGGTGCTGCAGGCCATGCTGCACTA
CCAGGTGTATGCAGCAGAGCGAACCCGCTTCCAG
gtgaggggccaggctggaggtgggatgccagctgggtggggcagaggatgtcacatgtga
gtgagagcctgaagattctttgcagcagaaactgggggaaaaggaaagtaatgtggtctg
catgcctgctcctggaaggtaacaggtgaagagtactgggacctggaaggcttgcataaa

Exon 15 +      77006      77143   0   Internal    138   100   Excellent
ggaattttccaggcagaggtgaggtttggggcagcccagagtaaattggacagacctgat
tgggtggagagagcagatggggcattctaggtagtggaggcgacaggagtaaagatgcaa
aggccacacctgttgggaactcagccctctcctcctgctctgtcctgcatttccacctag
ACCCTGCTGAACGAGCTAGACCGAAGTCTGGGCCGGTACCGGGATGAAGTGAATCTGAAA
ACAGCCATCATGTCCTTCATCAATGCTGTCCTCAATGCTGGAGCTGGAGAGGTGGGGTGC
CTTCTCCTTGCCCTTGCT
gttccctgactttctggacctggggtagagtgtgtgagtgtgttgcttccccaataattg
tttttgctattaaacctgggagggctcctggggagttgcctacataggtagcatcatgca
cggtggacagacccagagctgagctggctgatgatggctcagggtggcagagaatcattg

Exon 16 +      78523      78626   0   Internal    104   100   Excellent
taaactaagaaataaggtctccattctttcttggaactctgggattggaagcagctccag
gtgagttagctgtgggagatgtgttgggtctgtggctagggtggtgatgagggctccact
ggggatgttgtggaaactgagatctgccaatgagtctggccctcccttggtgacccccag
GATAATCTGGAGTTCCGCCTACATCTACGGTATGAATTCCTGATGCTGGGTATACAGCCT
GTGATTGACAAGCTCCGGCAACATGAAAATGCCATCCTGGACAA
gtaagttccaagcacccgtctccattgcaaacctgtggggacagtgcctcagatggggat
agttgggacctttgtgaaggctgcccttccctctggagaccagctgccattcccagcgca
gattcagaatcagctctgtggggggaaggggtgcccttgcctgtcctctttgctgacctg

Exon 17 +      79689      79755   2   Internal     67   100   Excellent
cttataaagggcagacaatgggtgtcctacaaacagcggcttctttcccattttgccttc
attttgcttgaatgaagctttcagatttagccagtggggggctcgaaggggctgtaaccc
tcaaccaagggtgtgtcctggctgtaatgtctactctctctgtctccccattctgtctag
ACATTTAGACTTCTTCGAGATGGTGCGGAATGAGGATGACCTGGAGCTAGCCAGGAGGTT
TGACATG
gtgaggagccagcagggtggagcgattgcaatggggtagtagggttcttggtggccccac
agccacttttctagaccccgtgttgtggcagggctggtgtgggctggttccctggtgggc
acccccatggccaggtcctgtgatcagtcatagttcttcatagaaacacaaccaatagga

Exon 18 +      81421      81585   0   Terminal    165   100   Excellent
tttataaaattgactatctccctgttccttttgtctttctctttttaagcctgggccaga
ggcaggggaagaaaacctttcctatgagacagggcatagtggatggaagcagggtcttct
ctctcctgctgacttcctctgctgcctacccactgatcactgtgccctcttctctcccag
GTCCACATCGACACCAAGAGTGCTTCCCAGATGTTTGAGTTGATCCACAAGAAGCTGAAG
TACACGGAGGCCTACCCCTGCCTGCTCTCTGTGCTGCACCACTGCCTGCAGATGCCCTGT
AAGTACCCTGCACTTGCTGCTTCCCTCGACTGGCCTGAACCTTGA
cttggggcaggtttagacaagactttgggacctccctggtttggggagtctgaccatgtc
tccctgtgcacttgcttttgggagggcaggccccatgacggaggcccctgcttttccttc
cctccttggggtcaggtcttcactgtcatctggggaaggagctggggacttggccctgag

Exon 19 +      82203      82288   0    Initial     86    82        Good
catctatgggagcagatggctaagttcttaagatccaggtgtgcacagtgattgaataaa
ttgtacataattgctaatagccactccagaatgcaatttgaaatgagctttaactgtacc
ccttggtacttaagctcttcacaaaagagaatattttgaaaaccagtgtggcccaccata
ATGGTTGATGTTGGCGGTGTCAGCAATCATAGTGACAGTGATGACAACTGTGACTTATTG
TGTGCCAACTCTGGGCCAGGCGTGAT
gtgaggtcctttagcacatcatctctgaaccttagaatgacctaaggaatacacattatt
atgtccatttgaatagtgagtgaacctgaggctcagcgagatatttacatatagaaagaa
ttttggtttctgcggggtcaagggttgagataaaacatgttctgcctctttgagctagtg

Exon 20 +      82809      82920   0    Initial    112    52    Marginal
atagaaatctctgggaaacctgacttcttgtgctcccagggattcctgtgtttcctgttc
catgggcaatgtgaatgggttcttctactctgccccaaaatggggctttgcagactcgat
attctaccttgtaggcattgtggtttgctttgatgtcaggattgaacttgttggcttttt
ATGATGGTCAATAAAGTGCTAGGGATCAAGGACCAAGGAAAGAGAGTTTGTGGTTATTAC
ATAAAAAGGAAGTCCATGTCCAGCCAGATGACTATCATTAGAGGGGATGAGA
gtgagactctatgagatcacacacaacacactatgcctttaccttcatagttcaaggtca
cttccacaagaaattttctcgagttccattaagcacttctctaacccattttgactctca
gtgcacacctgcaatcagtttcccttcatctttctctgtagagtaataatgtggataatc

Exon 21 +      83513      83651   1   Internal    139   100   Excellent
gatgactgaatcagtgagttgccattatcagcaatggcattgcctcttcttctagactgg
gagcttaccataggtggagaagggcatgcctcaccagccagaccccaggcagcaactcta
gggtggggcccaagggggacttcaggactcaggaaagatatgatacctgtcatccctcag
ACAAACGGAACGGTGGCTACTTCCAGCAGTGGCAGCTCCTGGACCGCATCCTCCAGCAGA
TTGTCCTCCAGGATGAGCGGGGTGTGGACCCTGACCTGGCTCCCTTGGAGAACTTCAATG
TCAAGAACATCGTCAACAT
gtgagcagtggccagcctttgccctgtcttcctccaccttcctcatcactctcccactct
ggtctcaccagcgaaacctcagctccctttcgcaacccagtcatcccgaaatgagtcttg
ggcagcatggtccaacagaactctctaagctaatgaaaaaagtgcatttctctactgttc

Exon 22 +      83835      83876   0    Initial     42    59    Marginal
agcagtggccagcctttgccctgtcttcctccaccttcctcatcactctcccactctggt
ctcaccagcgaaacctcagctccctttcgcaacccagtcatcccgaaatgagtcttgggc
agcatggtccaacagaactctctaagctaatgaaaaaagtgcatttctctactgttcaac
ATGGCAGCCAAATGTGGCTATGGAGTACTTGACACACGGCTA
gtatgaccaaggaactgaatcttaaaggttgtttcatttaaatttcaatagccacatgac
acgtggctagtgattactctcttggacagccaacacaggtgtattgggcatgttctcaac
tctccacgatccactgcatggcttggatagatggggaatttaaacacattaacgtagaac

Exon 23 +      86386      86444   2   Internal     59   100   Excellent
tgtgaacggggcaggggacctggagagacacctgggaagtctaaatcctagcccccttga
tgtggctggacagattggagaccagggtccccacctggagggtagaaagatgatgtctcc
tgggaagctgtgaatcaatggtcaacaatcacattgccccttccctctatgccctgccag
GCTCATCAACGAGAATGAAGTGAAACAGTGGCGAGACCAGGCAGAGAAGTTCCGGAAAG
gtgaggggctctgcttaagcctgctgtccactccacatgcccttcccctgcccagcccat
aactccatgcccttccaggcagggagtcacattactcacattctctccttctgtttcctc
tcccgtcccacccccattccagaacacatggagcttgtgagccgtctggagaggaaggag

Exon 24 +      86587      86771   1   Internal    185    98   Excellent
gaaacagtggcgagaccaggcagagaagttccggaaaggtgaggggctctgcttaagcct
gctgtccactccacatgcccttcccctgcccagcccataactccatgcccttccaggcag
ggagtcacattactcacattctctccttctgtttcctctcccgtcccacccccattccag
AACACATGGAGCTTGTGAGCCGTCTGGAGAGGAAGGAGCGGGAATGCGAGACAAAGACAT
TGGAGAAGGAAGAGATGATGCGGACGCTGAACAAAATGAAGGACAAGCTGGCCCGGGAGT
CCCAGGAGCTGCGCCAGGCTCGGGGACAAGTGGCAGAGCTGGTAGCCCAGCTCAGTGAAC
TCTCA
gtatgcaagcatctccccctttacatagttgagccaagaccctgggcttcaggactgggt
gggcagagcaggtgtcggagaggccaaggaccccagcatgagggagaagggagatggaga
ccttgggccaggatagaagagacccttgaggctgtacaggtggcatctttgtgttagaaa

Exon 25 +      87565      87660   0   Internal     96   100   Excellent
ccccctgggggcccactcaccttgtcttcctcaatgacaaccaatgacctgcctccaccc
cctcctcctctgccctttgcctgttgtccccctcccccaccaccaccccttcctcccggg
ggacccccgactcccccaggtgccccaccttgcctcggcatgggcctgcccctccctcag
GACCCCTACCCCAGCAGTGACGTCCCACTCAGGAAAAAGCGTGTCCCCCAGCCTTCTCAC
CCACTGAAGTCCTTCAACTGGGTGAAGCTGAATGAG
gtgagcatctgggaaggggctggagggcccattcttctacagcagggcagtcagcctcag
ggaccacccgccccttgtttacagatctccactctgggtcctttctttggtggggggtaa
gggcagtcatgtggatgtacaaagtgggtttgctgtgccaggcagctcacggtcagaaca

Exon 26 +      92145      92252   0   Internal    108    95   Excellent
ggagcagagtattcaagagagttggaggttgaggggagcaaccgactaccttctgaaggt
ctgaaatcctggtcatcttagtatgtgcagttgggagataagtggggttagggaggcatg
gagcatcttcatgatggagttgggccaaccatgggatcttctccctaccctgaattttag
GAGCGTGTCCCTGGCACCGTATGGAATGAGATTGATGACATGCAGGTATTTCGGATCCTG
GACCTAGAGGATTTTGAAAAGATGTTTTCAGCCTACCAGAGGCACCAG
gtaagaccctataccctctggcctcttggaccatacccttgaatccaaacctcagcttct
ccttttctttctgcctgcctgccttcctttcctttcctttccttccttcccttcctccat
cttccccttcccttccttctttccttccttcctcacatgtatactgaatgattttattct

Exon 27 +      95669      95904   0   Internal    236    99   Excellent
ccagataccgtctcttaaagttagctattatccaccctcctctctctcctgtctttttct
tcccccttcccctcacaccaggagcattcctggattggtaggaggtggctcttgcggggc
gggtaagaggaggattagggaacccacacctcaactgtccacttgacttgttggttgcag
AAAGAGCTGGGCTCCACTGAAGACATCTACCTGGCTTCCCGCAAGGTCAAAGAGCTGTCG
GTCATTGATGGCCGGAGGGCCCAAAACTGCATCATCCTTCTTTCCAAGTATGTGCAAAAG
AAGGTGGTTGAGTTGGATGCCTGGGGGACAAAGGGGGTGGAGGAACGGAGTGGTGGCAGT
CTCGGGCCTCTCCCTCTCTGCTGTCCCCTGGGAGGGGCAGGCATTGATCTGGAACT
gtctctcgggaacctgccttgagcagcagtttggggctctgcaggcaggaaactgcccag
tcacgaggcccttgcccagcctggtcagcgtctggcagctgagttgctctaagcccacgg
agggcctcgcttggctcaggccatggagcagcatgatctcagcccctaagcatttcccgc

Exon 28 +      96862      96946   2   Internal     85    91   Excellent
tcaagtttgtggactgaatcatactagtctaatctaagaaggctttgtagaggaggtgag
gggggaatactattaaatatattcccaagtcctgttagggaatgagggaaggcggaggtg
gtaccttttggagaagaaggtttgagggctgtcctggattgaggtggggttttgccttag
GTTGAAGCTTTCTAACGAGGAGATCCGGCAGGCCATCTTGAAGATGGATGAGCAGGAGGA
CCTTGCTAAGGACATGCTGGAGCAG
gtgaggaccctcgtgggaaggaaggggaactgaacccagcgggcagccacgccccttccc
aacagcccccaggaggctgcgattcttgggtcaaggagaaatcaggctggaagagttagg
gagaaggtttatagaagcctccctgggccagcctttcttggggaaagctggaaaaggcta

Exon 29 +      99524      99647   0   Internal    124    96   Excellent
cagagctgtgtgccctgtcatccccttcaggcagatgaaagaaatctgtccacatgaggg
tgcctccctctttcaaggcaccctccccatcttgacccaagtcagtacagcttctcacac
cctgtaccccatgtctgctgctcaccagttgcttgtgtgacttgcgcctgctctttgcag
CTCCTCAAGTTCATCCCAGAGAAGAGTGACATTGACCTCCTGGAGGAGCACAAGCATGAA
ATTGAGCGGATGGCCCGTGCTGACCGCTTCCTCTATGAAATGAGCAGGTTGGGCCATGGG
CATG
gtggggattcaagcaggtggggttctggcaggtggggcaggtggggctctgccaagagga
aggggatggaggtgggcaggcttgagaggagactggagctggctccgggagctggggctg
gccaggataggggtgggatacctcaagatatggttcaccttgtctacaggattgaccact

Exon 30 +      99797      99905   0    Initial    109    99   Excellent
tatgaaatgagcaggttgggccatgggcatggtggggattcaagcaggtggggttctggc
aggtggggcaggtggggctctgccaagaggaaggggatggaggtgggcaggcttgagagg
agactggagctggctccgggagctggggctggccaggataggggtgggatacctcaagat
ATGGTTCACCTTGTCTACAGGATTGACCACTACCAGCAGCGACTGCAAGCCCTCTTCTTC
AAGAAGAAATTCCAGGAGCGGCTGGCTGAGGCAAAGCCCAAAGTGGAAG
gtagggctgagggttgcaggaggcttagagtggagagttatctgagaaaggcagggtggg
tgggagccagtgaataggggcagagggaaacccctttcttattctcaacccaaaaacaaa
aacaaaaagtcaaagacaaaatctaaaatgatgattattataaaaatatgcacttgctta

Exon 31 +     100434     100502   0    Initial     69    42    Marginal
tactctacttaagaggtactaggctcatagaagacttctgggcacgttagtttaagtgtg
agccattcagaaagtaggaaattgcacaagctgatttctaaaggcatctgattttctgag
tcaggaacacttccaatacaggccatttccagatgagaaatttgtagttcaatgagaacc
ATGCGCCAAGCACTGTGTGAAGCACTCTGCTTGGTTGGTCCTCATTTGGTCATCACAGCA
ATCGCACGG
gtgggtgctattattaatttccatgtggctccattctctcctttctaaagtagggctgtg
ttaatgtcccgaggctgtgacactggtgagtggtggaaccagggtaggaatgcagatgct
gatcttcaaaatcagtcccttccctcttgtcccctagtactccccaggggctgcctgtgc

Exon 32 +     104995     105163   1   Internal    169   100   Excellent
gtgggtgaatgtgaaatcgatgggtctgctgaggagtaggtataatctctgcctcactga
gagttgaaggcatttgacagccccttttctgaactttgcggtggcatcttcctggggtgc
aatgagaactgctgccctgcctagcccatgcaggcctctgacctgtgcctcctctcccag
CCATCCTGTTGGCCTCCCGGGAGCTGGTCCGCAGCAAGCGTCTTAGACAGATGCTAGAGG
TCATCCTAGCCATAGGCAACTTCATGAACAAAGGGCAGCGTGGGGGCGCCTACGGGTTCC
GGGTGGCCAGCCTCAACAAGATCGCTGACACCAAGTCCAGCATCGACAG
gtgaggacctcccttcccggccacttccttggcctctatctcaccctaccctggcctctc
acatcctccctctattaggacgggaacatcctaagactcatcacccctttctcttaacac
tccatcctctgaccctctgaccctcgtgcccagtttcctctgtcacttaccactgacctg

Exon 33 +     105358     105465   2   Internal    108    99   Excellent
tcccggccacttccttggcctctatctcaccctaccctggcctctcacatcctccctcta
ttaggacgggaacatcctaagactcatcacccctttctcttaacactccatcctctgacc
ctctgaccctcgtgcccagtttcctctgtcacttaccactgacctgactttcatccacag
AAACATCTCTCTGCTCCATTACCTGATCATGATCCTGGAGAAGCATTTTCCTGATATTCT
AAACATGCCTTCAGAGCTGCAACATCTTCCAGAAGCTGCCAAAGTCAA
gtgagggttctctccaagacttccttctccccatgatgaccctcattcttgtcttacttt
cctcttttggggtctactctgggcttgatgatggctggtgtgagacctcggttcttgtct
tctgagttcaaaagaatttaaacagacacacagcaaagggggtttagcatagaacaatgt

Exon 34 +     106492     106581   2   Internal     90    50    Marginal
cagttaccaatcacaggcaattggtgcttaaccccatgaggaattctgggaaacagtgtg
gaatagttacttcagttttcccacccaaagggcaaggttgctggggcaatcagagagcat
ctcctctcagtaattggctgaggggctctgcaggggcagggaataactctctggccacag
GTACAGGTGGAAAGAGCTTGGCCTCAAAAAGAGTGTGCGTACAGTTGGAAGAGTTGGGGC
CATGCCCTACAATGGATGGTCCAAGGAAAT
gtgggtggggcaccaacagcatctgctaggcaagatatcagacacgaacatctaggctga
tagatgtcatctccaggaaaactagaaacatagtggtaaatggctcactggtatcgaatg
ctattgcttgcaggatcacataaagagcttataagcattacctggtagtaataaaaataa

Exon 35 +     107060     107120   2   Internal     61    84        Good
agaggcatgaaggggaggtgctttgtcagggccaacatcaatggccacaccagggctgga
acccaggctcaccgactcccaggccactgtgcttggctctgccctctccctgaaccagcc
ttagcacctcaaggcgggagttgatggtcctcattcccttccctctgtgtctccttacag
CCTAGCAGAACTGGAGAAGGAGGTGGGCAACCTCAGGAGGGGCCTGAGAGCGGTGGAGGT
G
gtgagtaccttgtcagtgcctacctgggtgagggctgctgtcagcaaacactgttcgtca
ctgcaccctaagctcctacacaggggcaaaaaacaatgggtacagcctctagcacagggt
cagccctcccaaaggataactggattactggggcttaagtttgagccttttaaaaggggt

Exon 36 +     107688     107731   0   Internal     44    62    Marginal
cctgtttcctgggccagtggaggacccaggtcttttgttcccaccattcccgttctgatg
gcttctcggctgatactatctctggccctagccttccagaaaacaccagtagaggagtgg
ggaagtgagccagactggcccagtatggggatgtctctaagtcttgtcccccacacctag
GAAGAAGGGACCCGTTCCGTCTTCACTGAGGAGAGAGGCAGTGG
gtaagggaagaatggactttagagacagattaaggatgacaaagaacgttttgttgccac
tacggtgggggaagatgatttccaaatttacaattttatagtcctgttaagtgctactca
aagtgcggtacatggaccagcagcttctgaatcagctgggagctttagaaaaatgtctct

Exon 37 +     108260     108391   0   Internal    132   100   Excellent
ggtgggctggctgctaatgttagctcatagtctttgccatccttagaactttgagatgca
gggtgttccctcttccaaagggctcaatgtcctgtgagtgacgaggggagatgtggtgac
ccctgcacccgactctcatcttggcaccagtctaagcagcacttcaccctccctcctcag
GAGCTGGAGTATCAGAGGCGCCAGGTACGGGAGCCCAGTGACAAGTTTGTCCCTGTCATG
AGCGACTTCATCACGGTGTCCAGCTTCAGCTTCTCCGAGCTGGAGGACCAGCTAAATGAG
GCCAGGGACAAG
gtaagggtgccccaacccccactgcttgccaacccagccttatctaaacaagctccttca
cccattcctaccacagacagcccaggagggacaaacccagagttacagagctttgagaga
aaaccgtttcttcgctcttaacaagacaagcaatgataaccacataccgcaaagatcatg

Exon 38 +     109485     109655   0   Internal    171   100   Excellent
cttgtctctgatcctgatgatgatgggggtgtcttctcacctcttccagccctgccccct
gtgccaacagtccccagccttgcgctgggctctgctctggctagaacccagctaacctca
ggggctgagcccagcatgctccagggcactctccaccaatcctgttctgtcccttgacag
TTCGCCAAGGCCTTGATGCACTTCGGGGAGCATGACAGCAAGATGCAGCCAGACGAATTC
TTTGGCATCTTTGATACCTTCTTGCAGGCCTTCTCAGAGGCCCGGCAGGATCTAGAGGCC
ATGAGGAGGAGGAAGGAGGAGGAGGAGCGGCGGGCGCGCATGGAAGCCATG
gtgaggggcagtgccaggcctgggactgaggggagacgggtgctacttggggagaacacc
cccaaactggggtgtgtgggaggagggcagagactgaggaactgaggaacaccatagggg
ttggatgtcagccccaggagagagaaacttcttcccagcctgagggaagagagtggtgtg

Exon 39 +     109996     110220   0   Terminal    225    95   Excellent
tgagggaagagagtggtgtgaagctgggggcctgtatgtcctaggcaggaagaaagtggg
gccaacagatacaggcaggcagcatgaccatggcctaggagttagcccagggttgggggg
ctgccctggcctcagcgcctctccctgagagggttcctatctttggccccccgcccgcag
CTGAAGGAGCAGAGGGAACGTGAGCGGTGGCAGCGGCAGCGGAAGGTCCTGGCTGCAGGC
AGCTCGCTGGAGGAGGGAGGAGAGTTCGATGACCTGGTGTCGGCCCTGCGCTCTGGGGAG
GTCTTCGACAAGGACTTATGCAAGCTCAAGCGCAGCCGCAAGCGATCAGGGAGCCAGGCC
CTGGAAGTTACCCGGGAGCGGGCAATAAACCGGCTAAATTATTGA
cctggggaactagccacacaggaggccgggagacagggactggtgagaatggggctgagt
ggaggaggtggtgatatttaaaccatttggtgcttggtttagagccttgggctgggtcct
gggatggggggctgtgtgtggctggaccaggtgtctccccacgcttaccttaaggggctc

--------------------------------------------------------------------------------