--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (61877 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (17 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        409        453   1   Internal     45    54    Marginal
ctgaccataattgcacagaatgtgtgtaaataaaagctaaaaggaaaaagaaaattctgt
agctcttccagaagaggcaaacggagaaatgaagaaatataaagagataggcactatata
aatactaagtactataaatagggcatttcccaacccactaaatattttgatattttccag
GGATGGAGCCAGAGATGTTCTGGAAGGATGAAGGAGACTGCATGA
gtaattggggtggggtagcagagagtttgccaatccctacctcactgggttttagttatg
tttcagttaatctgcctcctcatttacgaggcgggtattgttagctccacttttcagatg
aggatactgagattcagtaaggttattacccaaacttatgagaaagccaagatttcacaa

Exon  2 +       1460       1504   0    Initial     45    42    Marginal
ccacccaatatctcgcgagacttgctattctgcgccccctcccaccttgcgcttgcgcag
atcttcaaagcagaaggtcgcgcttggaggaagtggcggctttgagtccggtggcccaat
cgctgttactacttctctgaagctcctctcggctgcttgccgagacaccctgccgccaag
ATGCCTCGAATTATGATCAAGGGGGGCGTATGGAGGAATACCGAG
gtaagtctccttttcccgccgtccgctgcccgccgctccctctagcagcttgtgcgcacg
cgcgcggaggtcgggggggcgacgaggagaccctgtggggtctgcgtggagggcagcccg
ggggctgacccttggggccctttccgtgtgtctggccccgtgttgtgcgagcgccagtag

Exon  3 +       6303       6464   2   Internal    162    91   Excellent
aatgtgatgagatggggaatattgactggggtaagtgtaaccacacagcaaatattctgt
tgtcaaaaagaacagtttttgtaattgaaggatgagagcacaagtcagtgtatccattgt
gcaaattggatatttatgccaggtaactgattaatatataaaatgatctatgtttaatag
GTATGAATGGCTGGATCCAAGCATTAAGAAGACAGAATGGTCCAGAGAAGAAGAGGAAAA
ACTCTTGCACTTGGCCAAGTTGATGCCAACTCAGTGGAGGACCATTGCTCCAATCATTGG
AAGAACAGCGGCCCAGTGCTTAGAACACTATGAATTTCTTCT
gtaagtgagtcttcagaaagagcatagaatatatgtatatgttctgaaagaggctgaata
aactttgagtattttctgtctttaaacttttaattatggatgtgagtaaacccaaagcta
aagccattggataatattttccatatctcagatggttgatcaaaattatgccttctgtca

Exon  4 +       7082       7209   2   Internal    128   100   Excellent
gaaatcagcaaattttaatatcatttctttcagatgaagtgatagtaaaaaggctttatg
ttgttaaagcccatccattggtttttttggggggaaaaatatcgtcagaacttggaaatc
tggtaattttaactctaaatggtactgtagtgtgactaactcctatgggcttttttctag
GGATAAAGCTGCCCAAAGAGACAATGAAGAGGAAACAACAGATGATCCACGAAAACTTAA
ACCTGGAGAAATAGATCCAAATCCAGAAACAAAACCAGCGCGGCCTGATCCAATTGATAT
GGATGAGG
gtaagtgtatgctttgaggaatttatttctttggtaactgtaaactccttgggcctcact
cttttagttcctttctgaactcctctactttagaatcccttttttttttgagacaaggtc
ttgctctgttacccaggctggaatgaagtggcacaatcatggttcactgcggttttgacc

Exon  5 +       9977      10076   1   Internal    100   100   Excellent
gtttttaacctaggttctttgacttcaaaactcaagctgtttccattatgctacaccata
aaatcagtatttttatgtttttttctcattttgagcaatagagtgtctcttacatacctt
gcttctagagtatgtaagaactaagaaaatacttagtttttcttcttttaatttttgcag
ATGAACTTGAGATGCTTTCTGAAGCCAGAGCCCGCTTGGCTAATACTCAGGGAAAGAAGG
CCAAGAGGAAAGCAAGAGAGAAACAATTGGAAGAAGCAAG
gtatgtgtggatataggaataaaaagcaaagtgtttttctcacataacaatcaacacaga
atacttctgtgaccagatatgtggtttttttttttttttcccctctccaccagcaatcag
gcaatcaattctgcagtggatagctgggtgtcctctaattcagttaactctaatactgtc

Exon  6 +      17445      17663   2   Internal    219    85        Good
tgtatgtgtgtgtgcacctttaaattaaaactaggatttgttttggtgaatggtgtgagg
taaggatttaaataactatttcttccccaaataaatagatactttttttttaactgtatg
ggataatttatccctgtcacatggcatatgattttcaaagtgattttgcattcttttcag
ACGTCTTGCTGCCCTCCAAAAAAGAAGAGAACTTCGAGCAGCTGGCATAGAAATTCAGAA
GAAAAGAAAAAGGAAGAGAGGAGTTGATTATAATGCCGAAATCCCATTTGAAAAAAAGCC
TGCCCTTGGTTTTTATGATACTTCTGAGGAAAACTACCAAGCTCTTGACGCAGATTTCAG
GAAATTAAGACAACAGGATCTTGATGGGGAGCTAAGATC
gtaagttgcctttctgattttggaaatggaaaggaatagtaggaggagtcttacgaaggg
ccaagtattatccttgtcagagccagatttttattatttatttattttacattttttaaa
atcaattttttttttgagacagggtcttgctgtgttgcccaggctggagtacagtggcac

Exon  7 +      21008      21032   2   Terminal     25    72        Good
tttttgagacaacagttgtgaaagtcaatgtgggagttgtggagaaaagcgatacaaaca
ttctttcattcagcttattacaggctgtattcttttgacttactatagttggtcagaaac
atgggaccttagggtaacctttttttttttttttgagacggagtcttgctctgtcgccag
GCTGGAGTACCGTGGTGCCATCTAG
gctcactgcaacctccgccttccgcgttcaagcgattctcctgcctcagccttccaaata
gctggaactgtaggcgtgcgccaccatgccccgctaatttttgtatatttactagagaca
gggtttcaccatgttggccaggatggtcttgatttcttgacttcgtgagctaccatctac

Exon  8 +      21749      21898   2   Internal    150    67    Marginal
gaccctttctgtgtgatattttaattggttttcagtcttcctcctccaattttgtataaa
tactgctattttacattcttggtacgttaatatgttgatttgaaagaatttcagtataga
gatacagcctttgtagcttgattctatatcatatgtgaattttcccctcacattctgtag
GGAAGGCTTTCTAAAGCTATATTATGGAAACTTTCAAAGCCACAAAAAAGATGAGTACTA
CTGTGAACTTGTGATATTAATCACACAGCTTCAGCAATTCATTTTTCTGGAATATGGAAA
TTTAAAGCTGTGTCAGCTCTCAGTTAAAAT
gttggtttttttttttttttcaatagagacagttttgctgtgttgcccaggtaggtcccg
aactcctgggctcaaacagtttgccctcctcggcctcccagagtgttgggattacaagtg
tgagccactgtgcccggcctcagttaaaatgttgcttactatgataattgtgtcctttta

Exon  9 +      22181      22268   2   Internal     88    72        Good
gtgttgggattacaagtgtgagccactgtgcccggcctcagttaaaatgttgcttactat
gataattgtgtccttttagatttcagatgcagaactccaggaagttgtaaaagtaggcca
agcgagtgaaattgcacgtcaaactgccgaggaatctggcataacaaattctgcttccag
TACACTTTTGTCTGAGTACAATGTCACCAACAACAGCGTTGCTCTTAGAACACCACGAAC
ACCAGCTTCCCAGGACAGAATTCTGCAG
gtaacgtgtcacgtagtagaatgaggcttttactttgtttattgtccttagaagtatcat
gcaggagaactaagcggtttggttgtgtttcttttagtgtaaatggtttgaaactgagtc
ctgaatgcatagatcttgcaatatttctgtagtagagaagctaaatagattcagcaatca

Exon 10 +      33085      33213   0   Internal    129    97   Excellent
tgatagaaggaatggaaacattgaaatctgccatgactggtattcattttctctgttagc
tttcattgagaaaatgagtaaggattctgcctgcttcaagattggtatagtaggaccaga
agagattctgcaagtctgtctaaacttttaaacttgcttctttgtcttcttgttaatcag
GAAGCCCAGAACCTCATGGCCCTCACCAATGTGGACACCCCATTGAAAGGTGGACTTAAT
ACCCCATTGCATGAGAGTGACTTCTCAGGTGTAACTCCACAGCGACAAGTTGTACAGACT
CCAAACACA
gttctctctactccattcaggtattgtaaatgaacacgtttttattttagaaaaacttga
attcaaggacttagcatatttgctttagtaatgtttacggagaatgactacttattgtgt
tggattttcctctttgatttcttcttcatagtaataaataatagtgtccaggaaatggtt

Exon 11 +      36283      36445   2   Internal    163   100   Excellent
agctagaccaaacattgattttaacctagagatcctaacaaaaccagctggacagaattt
tgaaatctttattcttttttttttctatatttcctgtgaaataatttatgtgaaaaacat
ttgaaagcacaatccaaatgtaagtggcacttctgttaattgggattcctgtctttctag
GACTCCTTCTAATGGAGCTGAAGGGCTGACTCCCCGGAGTGGAACAACTCCCAAACCAGT
TATTAACTCTACTCCGGGTAGAACTCCTCTTCGAGACAAGTTAAACATTAATCCCGAGGA
TGGAATGGCAGACTATAGTGATCCCTCTTACGTGAAGCAGATG
gtaaatgtcaattcccttttaatactcttaaatttttttttaatatctcatggatgccaa
attaaaatttctcctgttagtgcatatcacatataccttaagaatctatacacctgtgga
tgccagaaaaagaattatttgtaagacttgatgaaagggaatattttgggctcaaaaccc

Exon 12 +      38055      38243   0   Internal    189    98   Excellent
catcccctcaagcatttaacctttgtgtttgaaaccatccaattattcttagttatttta
aaatgtacagttattttgactagagtcaccctgttgtgctatcaatttttaagagactca
taaaatactggtggaatgtttaatatgcatgaattgagaaggaccacttcttttctacag
GAAAGAGAATCCCGAGAACATCTCCGTTTAGGGTTGTTGGGCCTTCCTGCCCCTAAGAAT
GATTTTGAAATTGTTCTACCAGAAAATGCCGAGAAGGAGCTGGAAGAACGTGAAATAGAT
GATACTTACATTGAAGATGCTGCTGATGTGGATGCTCGAAAGCAGGTGGGTAACTGTACT
GAAAGAAGC
gtgagtttggctgaatgtgtcagtaggctggaagaatgaagaatagccattaaatgtccc
aagatctctacctagtcctttttaatattgaaaaaacttctaaagtaaataacttatgtc
attaataatgtatcctcacataattaacatactcacaatattttgatgagcattcttaaa

Exon 13 +      38940      39073   0    Initial    134    77        Good
aattactttctcatttgcacgtaacagcacagtgatataaataggatcggtattacaggt
tgaacattgctaatccaaaaatccaacacctgaaatgctccaaaattcaaaactttttga
gtgccgacatgaagctcaaaagaaatgctcattgaagctttttggattagagttagtata
ATGCAGATGTTCCAGAATCTGAAAAAATCAGAAATCCAAGATACTCTGGGCCCAGATATT
TCTAGTAAGGAATACTCAACAAGCTCAGATGAATTGAGGTCTCATGGTCTCAACTTTCTC
AGGTCTCATGGTGG
gtaagtggtgaatcctaaactagaactgatattttatgacccctttcagtagctgcagtc
cattgctggatgattttagggaccttgaatctcaggggattggagtgagaatgacatcag
tggaaacaatattttagaggggacccatgtaaatgtgcttttcagtggggaacagaggat

Exon 14 +      39739      39819   0   Internal     81    76        Good
gagagtgaatagactgattcatttctgttgccttagcattgcctttctacaaacttaaac
cgatttctaaactttagctattgaacacacatgatcttacataccaaagtgtttttagct
ttactgagagatatcaaatacgctatagctgcaataaaggatataaaaatcattttttag
GCCATACGAGATGCAGAGCGTGTAAAGGAAATGAAACGAATGCATAAAGCTGTCCAGAAA
GATCTGCCAAGACCATCAGAA
gtaagtgttagaatttctggtttaggaagttttaagtttctttttatatgattgctgcgt
tttacatcattcataaagactataaaacaaaatttcatctactttctggaatatagcaaa
gtagttctcaaatccaatctttaaaatgtttcagtagtaccagaaagaatttagaaggaa

Exon 15 +      40118      40360   0   Internal    243   100   Excellent
aagtagttctcaaatccaatctttaaaatgtttcagtagtaccagaaagaatttagaagg
aaaaaaatggaaattgcttttgaaaatgtaaaaccgctgtttaattcatgctgtaacagg
taataacattaatatattatagtgatatgtttggtaattgtatttgttttaaaattttag
GTAAATGAAACTATTCTAAGACCCTTAAATGTAGAACCGCCTTTAACAGATTTACAGAAA
AGTGAAGAACTAATCAAAAAAGAAATGATCACAATGCTTCATTATGACCTTCTACATCAC
CCTTATGAACCATCTGGAAATAAAAAAGGCAAAACTGTAGGGTTTGGTACCAATAATTCA
GAGCACATTACCTATCTGGAACATAATCCTTATGAAAAGTTCTCCAAAGAAGAGCTGAAA
AAG
gtatgattgagctggaatatttcttcttgagatttaggtagttgttaggtgctgtgtatc
atggacaaataatgaacttatttttccctgttggtattcataaacaactgaaatgtatga
ttaggagatgcatgtttagattaagtgttatgaaaaggacatgctttaaatacctccatc

Exon 16 +      43373      43546   0    Initial    174    85        Good
tttttcctaggtattgttatccacccttccaaaaaacaaccaaccacatcttggatttga
ctcaaggcatgagggaaaaaattagtcttctaaagctctctggatatggcaagtgtttgt
agtacttaaacttattgaaattattattgtaaacaggcccaggatgttttggtgcaggag
ATGGAAGTGGTTAAACAAGGAATGAGCCATGGAGAGCTCTCAAGTGAAGCTTATAACCAG
GTGTGGGAAGAATGCTACAGTCAAGTTTTATATCTTCCTGGGCAGAGCCGCTACACACGG
GCCAATCTGGCTAGTAAAAAGGACAGAATTGAATCACTTGAAAAGAGGCTCGAG
gttggtatccttttaaaattttaattttaaatgtactttgattgagataatgaactaaat
aatgccactggagacaatgtcagaaaaacacacctgaggtgcttattgcctttttagttg
ttggagaaaactacacttaagtgttggatcttcttggccttgttcattgtttttttttgt

Exon 17 +      59291      59620   0   Terminal    330    89        Good
tttaggtgcaagataaatccttcttaagcttgatattttgttacagtaattgagctataa
ggagttctagtgtatttttgctttgagacacatacatgaacgcatggtacctttttagcc
ctgttatttaatagcctgcttttctcatgtatgctgatgtgatcttcccctgctctccag
ATAAACAGGGGTCACATGACGACAGAAGCCAAGAGGGCTGCAAAGATGGAAAAGAAGATG
AAAATTTTGCTTGGGGGTTACCAGTCTCGTGCTATGGGGCTCATGAAACAGTTGAATGAC
TTATGGGACCAAATTGAACAGGCTCACTTGGAGTTACGCACTTTTGAAGAACTCAAGAAA
CATGAAGATTCTGCTATTCCCCGGAGGCTAGAGGTAACGTTATATATTGAACTGTTGTTT
AAAAAGAGTGCTGCAAAGAATTATCAGGGCTGTCCTCTTTTACTTCTCCTATGTAGACTG
TCTCTGAAGTTGGTACTGTCAGGCTTTTAA
aaatgagagcctaaagtgtttgactttctaatctagaattgcctctgtgtagatggatag
accaggcaagttgtagatacaaaggccttcccttactcattttctgtttccaatatgtag
atacactgtgaaatggaatacttagcccttgtgatttgtccccttgaaacttaattgcat

--------------------------------------------------------------------------------