--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (14076 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2903       3068   0    Initial    166    90   Excellent
cagtttattgtcgtggggcccactgatcccatcttggccacggttggagaaaacactacg
ttacgctgccatctgtcacccgagaaaaatgctgaggacatggaggtgcggtggttccgg
tctcagttctcccccgcagtgtttgtgtataaaggtggcagagagagaacagaggagcag
ATGGAGGAGTACCGAGGAAGAACCACCTTTGTGAGCAAAGACATCAGCAGGGGCAGCGTG
GCCCTGGTCATACACAACATCACAGCCCAGGAAAACGGCACCTACCGCTGTTACTTCCAA
GAAGGCAGGTCCTACGATGAGGCCATCCTGCACCTCGTAGTGGCAG
gtgcgtcgcttcattttgctttgttactttggcacagtgtgactttggggaaagtttctc
tcctaacctcaggcccattgcagaccagcaaatttttgtctggactcccttttccactct
ccctgtggaaacggaattccagggaaaaatccttcctcctgcacaagggacacatgagtg

Exon  2 +       6037       6137   0   Internal    101    97   Excellent
agttggatttgcaggctagatctgtcaagtctcctaaaaaccatcacctcctatgggtgg
tagaaagcggtggttatgtgaagttctgaactagacagaagggtcaatgtctttggatca
aaaggtttcttaggattctgcccgcctggcagactttcgtccttctcgttattattctag
AGCTTCTGGAAGCTGAGGTCTACTGAGAAGTCGTCCCAGAAGCAGAAAGTGAAATCCAAA
ACCTGCCTGTTTGAAGTTGGAGTCGACACACCCATCTCAAA
gtgagaaaattagtctggcaggataaattgaacaagcatttatggcagacagatagatgc
ttggtgctgtgatggggcctataggtggaccgcaaagaaaagggtgcaatgggatccttt
cctcttagagagctcacagtttatgtggcccattggcctgctggtgttctccaacatcaa

Exon  3 +       6484       6765   1   Internal    282    74        Good
ttctccaacatcaatgttctttcttccttaccctcatcctttttttcttccttcctattt
cttgtttcctatctccctcttttttacctttactttctagcttcacagaagagatgcaat
aggcacagaagagatgcaaaaggcactgacttttgcctgaaccctgatatctctccacag
GACTAGGCTCTAAGCCCCTCATTTCAATGAGGGGCCATGAAGACGGGGGCATCCGGCTGG
AGTGCATATCTAGAGGGTGGTACCCAAAGCCCCTCACAGTGTGGAGGGACCCCTACGGTG
GGGTTGCGCCTGCCCTGAAAGAGGTCTCCATGCCTGATGCAGACGGCCTCTTCATGGTCA
CCACGGCTGTGATCATCAGAGACAAGTCTGTGAGGAACATGTCCTGCTCTATCAACAACA
CCCTGCTCGGCCAGAAGAAAGAAAGTGTCATTTTTATTCCAG
gttagttctctgccctctgagactcgtcgagtgcatgggggatcctcagcacacagatgg
agcccagaacggggatgggggcagcagtgtgggtgaaatagtcctgggccctaaggacct
ggaggctgcagctgagtgaagcctttccgcttctcacaaaaggagaatcaaagtgtccca

Exon  4 +       6800       6904   0     Single    105    41    Marginal
gaaagaggtctccatgcctgatgcagacggcctcttcatggtcaccacggctgtgatcat
cagagacaagtctgtgaggaacatgtcctgctctatcaacaacaccctgctcggccagaa
gaaagaaagtgtcatttttattccaggttagttctctgccctctgagactcgtcgagtgc
ATGGGGGATCCTCAGCACACAGATGGAGCCCAGAACGGGGATGGGGGCAGCAGTGTGGGT
GAAATAGTCCTGGGCCCTAAGGACCTGGAGGCTGCAGCTGAGTGA
agcctttccgcttctcacaaaaggagaatcaaagtgtcccaaaactcaggagtaggagcc
tcttctctgagggtaaacctgtttttgttgttgttgttgttgttgttgttgtttttcccc
ccaataaggtccttacactgctgcaatttttttttaagacaagttcttgctctgtcacac

Exon  5 +       7450       7561   1   Internal    112    66    Marginal
gacctcaagtgatccacctgcctcagccttccaaagtgctaggattacaggcgtgagcca
ccatacccggccagcaatttttagacattgaaaacaaccataacatatggagggtggtgt
ggataagtgactctctacacttggtgttcctgtatgctgtagccatcccttcctgtgcag
GGGATTTTCCACAGGACAGAGCTGTGGAAATTCCCTATAGACACACACTCACAATTCATT
CAACAAATGGTCAAGAAGCATATCGTATGTTCAAAACACTGTTCTACCAAGG
gtaaatcattgaacaaattatattaagaactcttccctcaaaaagtgattagttagctaa
ccatatattctatcagatggtaatgaacatctataggaaacattaagcaaggaaggaata
aagaggcaatgtgagacattgcaattcttaacagaatggtcagggaagacttcactgtaa

Exon  6 +       8458       8615   1   Internal    158    89        Good
gccagcatcactttctccatctgagttttctgagggagaaagcaggagagcaggtggctg
aggagctcttcaagtgtgctcctaggggcactcttaccccagatgttctgtttcaaacta
agtggatatttctggctgccttttcagaatcctttatgcccagtgtgtctccctgtgcag
TGGCCCTGCCTATCATTGTGGTTATTCTGATGATACCCATTGCCGTATGCATCTATTGGA
TCAACAAACTCCAAAAGGAAAAAAAGATTCTGTCAGGGGAAAAGGAGTTTGAACGGGAAA
CAAGAGAAATTGCTCTAAAGGAACTGGAGAAAGAACGT
gtgcaaaaagaggaagaacttcaagtaaaaggtaaaagaggctgagtatggtggctcatg
gcttgaatcccagcactgtgggaggctgaggcaggcagatcacttgagccctggagttcg
agaccagcctgggcgataaagtgagaccctgtttaattaaaaaaaaaaagaaaagaaaaa

Exon  7 +       9302       9446   0   Internal    145    63    Marginal
attgtttactaaaaacccaacttcttttagttcttctgtcaaagacatgattttctttgt
ttgtttttcagagaaacttcaagaagaattgcgtaagtttagcctttccttaactacatg
tacaatttgagttctgctcagcaacatctcatgacattcgtctctgtctgtcccttgcag
GATGGAGAAGAACATTCTTACATGCTGGTGAGTGCCTCTGATGTTCCCTCAGATCTCAGC
TTTCTCCACACTAGCCAGCTAACAGGACTCCTTAGAGGAGATGAGCAAGGGGCCCAGGGC
AAGGTGGGGACAGCAGGGAACGGGG
gtcagttcatcaacagtgtcccagcaatgatgcatcatgtctcttctgtcagggaatccc
agcagctctcaatccaccctatggtttacatcccaggatcctttatcttttggagtaatt
taatgcatgattaccagaggtgtcccatatatagtagccttcctaagagttacatttcag

Exon  8 +      11188      11789   1   Terminal    602    75        Good
cagaagtgcagcttcagtaattctcagtgtgtgagctgcctaggatcagagagccttcat
ggaagtggccactacgtggggatcccttcagagatatctgagacctctctggggatcagg
aaccacacaatccccagggttcctgagaccccaggcctaaacctgagacttcctctgcag
TTGATGTGGTCCTGGATCCAGACACCGCTCATCCCGATCTCTTCCTGTCAGAGGACCGGA
GAAGTGTGAGAAGGTGCCCCTTCAGGCACCTAGGGGAGAGCGTGCCTGACAACCCAGAGA
GATTCGACAGTCAGCCTTGTGTCCTAGGCCGGGAGAGCTTCGCTTCAGGGAAACATTACT
GGGAGGTGGAGGTGGAAAACGTGATTGAGTGGACTGTGGGGGTCTGTAGAGACAGTGTTG
AGAGGAAAGGGGAGGTCCTGCTGATTCCTCAGAATGGCTTCTGGACCTTGGAGATGCATA
AAGGGCAATACCGGGCCGTGTCCTCCCCTGATAGGATTCTCCCTTTGAAGGAGTCCCTTT
GCCGGGTGGGCGTCTTCCTGGACTATGAAGCTGGAGATGTCTCCTTCTACAACATGAGGG
ACAGATCGCACATCTACACATGTCCCCGTTCAGCCTTTTCCGTGCCTGTGAGGCCCTTCT
TCAGGTTGGGGTGTGAGGACAGCCCCATCTTCATCTGCCCTGCACTCACAGGAGCCAATG
GGGTCACGGTGCCTGAAGAGGGCCTGACACTTCACAGAGTGGGGACCCACCAGAGCCTAT
AG
aatcaattccttggtctcacagccatgtagacaagccctggtcatctcagcagccaccgc
acaacacccctggtggaagacacgccctcctcccctctggtcacacaagagaacatcttc
cagctgcctctttcacacccactacagacctcagccccagttttctcctcctcactaggc

--------------------------------------------------------------------------------