Gene TCOF1 Variant 1
DNA : 42.62 KbNT_029289
mRNA : 4816 bp NM_000356
CDS : 4236 bp NP_000347
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  183 bp
gggggcgggtccctgtctagccccgcatgctccgcgccaatgggcggtattgttgatcac
gagtctccgcccccttcgccttgaggggcggggccggccactcccggagaggggactacg
tttcccggcgcgccgcgcggccggagcgaaagaggagccggaagtgtggcgcgcgaggtc
TAAGGGCGCGAGGGAAGTGGCGGGCGGGGACTAAGGCGGGGCGTGCAGGTAGCCGGCCGG
CCGGGGGTCGCGGGTATGGCCGAGGCCAGGAAGCGGCGGGAGCTACTTCCCCTGATCTAC
CACCATCTGCTGCGGGCTGGCTATGTGCGTGCGGCGCGGGAAGTGAAGGAGCAGAGCGGC
CAG
gtaagcgttcgtgggccgtgtgcgagggccgcgtgcaagatgtggagatcagcggcccgc
ggcccgcgccccgtccccaggcgacccggcaggcgcccggagccgggtcccgcagtgctc
gacggcgcggccaggggtaccggaggagccgcaatctctgccttcccactgcgacttcag
EXON 2  56 bp
tcttcctgcctcagcctcccaaagtgctgagattacaggtatgagccaccatgcccagcc
aaaaagaccctcttctgaaccacctgtctatacaagtcatgagtttggggagatctgggc
ccaagaaggatccttactgtgctggggattaattgtggctttctctttacctctctgcag
AAGTGTTTCCTGGCTCAGCCCGTAACCCTTCTGGACATCTATACACACTGGCAACA
gtaagtggtggggcctatagggtggagtagggacggacaccccaagcaactcagcttgga
ataagctgggatacctatctggtctaagatctgtccccatagcccactgtggacaccatt
gttgcctccagaaagccagctcacatcacatggatgggtatttctgtgtggatatctggt
EXON 3  140 bp
tttatgaagtgagtgaaaatgcagaatacaaaattgtgcctatactgtgttttcaccact
gtttagattctatgcacattgcctttaagagctggaaggatgcgggaaggtctgtctagt
caattcttgtggagttgttctgtcacccagttggtatagacagtcacccttgtcctgcag
AACCTCAGAGCTTGGTCGGAAGCGGAAGGCAGAGGAAGATGCGGCACTGCAAGCTAAGAA
AACCCGTGTGTCAGACCCCATCAGCACCTCGGAGAGCTCGGAAGAGGAGGAAGAAGCAGA
AGCCGAAACCGCCAAAGCCA
gtaagagccttgcagctttgggaacaggctatggaatattgattgttctagggtagagtc
tacctccagcttcttctcttatcactagaagacctaaaagaccctggggaggagattggg
agggcaccacatatctttggcagtatttgagcccttcctccgtgccaggcattatatctc
EXON 4  74 bp
ggtggacctggctgatgcatcacagagctcattcctgcaagtctgggctcagcctcagat
cctcatgccagcaccaggcagccaataccaatagaattgttaggtgagatgaaacctgtt
tgccattcatagatgagaaaagctcatctggctcctttagcagatgtttgtttcttgcag
CCCCAAGACTAGCATCTACCAACTCCTCAGTCCTGGGGGCGGACTTGCCATCAAGCATGA
AAGAAAAAGCCAAG
gtgagtgggactgccttccaagctattgcctatgggatttaaggtgcctggtaggggaca
gtcttacatgtcagagaaggatagggttgtgagtaattgccccacctggattcagagctc
aacctgtgtcaccagttgtgggatcttagtcccttcacctctctgggcctcagtttactt
EXON 5  187 bp
ctctggtgagaggaggtgctgtttttaacctcactttaaagattgggaaacagattgaag
gggtagtttacccaaactcacacagctaagaagtggtaagattgggttcagatgcaagtg
gcctgtgctcttagttcaccatgccataccagatgtgtctgtcactcttgttctctgtag
GCAGAGACAGAGAAAGCTGGCAAGACTGGGAATTCCATGCCACACCCTGCCACTGGGAAG
ACGGTGGCCAACCTTCTTTCTGGGAAGTCTCCCAGGAAGTCAGCAGAGCCCTCAGCAAAT
ACTACGTTGGTCTCAGAAACTGAGGAGGAGGGCAGCGTCCCGGCCTTTGGAGCTGCTGCC
AAGCCTG
gtaagaagtccccacctctaggaacctagtccccagaacttgggctggtgaggcaggcct
aggcattgctttaagttctgggacatttctggaatcaaaagtttgtctccaggacagcca
ggttcctgcatcttaggacttttctcatcacctagacgagggagggtcagcttacaggga
EXON 6  74 bp
agggatggtgatggtacccacctcagaagggggcttcacagctcagtgcatgtgaggcac
acgaggggtgagcgctcagcacctggctttgatgagcagctggtttgtggggaggtgctg
gggaggggcaggtgaggctggaaagggagtccctcagtcccctccgtgtccgatcctcag
GGATGGTGTCAGCGGGCCAGGCCGACAGCTCCAGCGAGGACACCTCCAGCTCCAGTGATG
AGACAGACGTGGAG
gtaattgccacccatccctaggagttgccctctcccagcctctaacccttccaggaacct
gtctggggcttcagacaccagtgggcccagatgagttcagcaactgtggtagggtgacca
ggagctggaaaggctgcagccggagaggggcagggagaggagtctggtgctgcttgctgc
EXON 7  213 bp
ctgatcgatttttgagaaaccaggaggccagtgtggccaaagtatcagtcaaggtgggga
gtggggagggaagcaggggaggtcttaggagcctcattaaggcctctggactttatccta
aaggcatcaccagagagttttcacaagcaggagagcaagctgccctttctttttcaccag
GTAAAGGCCTCTGAAAAAATTCTCCAGGTCAGAGCTGCCTCAGCCCCTGCCAAGGGGACC
CCTGGGAAAGGGGCTACCCCAGCACCCCCTGGGAAGGCAGGGGCTGTAGCCTCCCAGACC
AAGGCAGGGAAGCCAGAGGAGGACTCAGAGAGCAGCAGCGAGGAGTCATCTGACAGTGAG
GAGGAGACGCCAGCTGCCAAGGCCCTGCTTCAG
gtgaggcctgaggagggagactccatgcagccaggcccgtccccagaaggccttctcagg
acttgttctcccactctgggccagagccccgggcgtgcctcagaccccagccccttactc
ccctctcactgtgtggcatcatttgccctatctggtcttctgtacgtggtgtcctgtgtc
EXON 8  195 bp
ccttctcaggacttgttctcccactctgggccagagccccgggcgtgcctcagaccccag
ccccttactcccctctcactgtgtggcatcatttgccctatctggtcttctgtacgtggt
gtcctgtgtctcctcacacgtccatcctctgggctgtctccccttgtcttgtttctccag
GCGAAGGCCTCAGGAAAAACCTCTCAGGTCGGAGCTGCCTCAGCCCCTGCCAAGGAGTCC
CCCAGGAAAGGAGCTGCCCCAGCGCCCCCTGGGAAGACAGGGCCTGCAGTTGCCAAGGCC
CAGGCGGGGAAGCGGGAGGAGGACTCGCAGAGCAGCAGCGAGGAATCGGACAGTGAGGAG
GAGGCGCCTGCTCAG
gtgaggcagaggggaggggtggagagtagccccatgcctaaaccccagcacctgcatggg
tgtggccacctttgccacatccagctcctgtctccacacgtccaccctctgggctctccc
ctcatcctgtttctcactccaggcgaagccttcagggaaggccccccaggtcagagccgc
EXON 9  210 bp
gcgaggaatcggacagtgaggaggaggcgcctgctcaggtgaggcagaggggaggggtgg
agagtagccccatgcctaaaccccagcacctgcatgggtgtggccacctttgccacatcc
agctcctgtctccacacgtccaccctctgggctctcccctcatcctgtttctcactccag
GCGAAGCCTTCAGGGAAGGCCCCCCAGGTCAGAGCCGCCTCGGCCCCTGCCAAGGAGTCC
CCCAGGAAAGGGGCTGCCCCAGCACCTCCTAGGAAAACAGGGCCTGCAGCCGCCCAGGTC
CAGGTGGGGAAGCAGGAGGAGGACTCAAGAAGCAGCAGCGAGGAGTCAGACAGTGACAGA
GAGGCACTGGCAGCCATGAATGCAGCTCAG
gtgaggctggaagccgccctgcatggcctgtgccctgcctcaaaagacctcctgtggttt
tgacttttcctctctgaacctagagccctgtgcggctggcttcgtttgctctcctcccct
cactcacattctccttctggactccctccctaatcttgtcctttgtgtctcccaggtgaa
EXON 10  216 bp
ctcaggtgaggctggaagccgccctgcatggcctgtgccctgcctcaaaagacctcctgt
ggttttgacttttcctctctgaacctagagccctgtgcggctggcttcgtttgctctcct
cccctcactcacattctccttctggactccctccctaatcttgtcctttgtgtctcccag
GTGAAGCCCTTGGGGAAAAGCCCCCAGGTGAAACCTGCCTCTACCATGGGCATGGGGCCC
TTGGGGAAAGGCGCCGGCCCAGTGCCACCCGGGAAGGTGGGGCCTGCAACCCCCTCAGCC
CAGGTGGGGAAGTGGGAGGAGGACTCAGAGAGCAGTAGTGAGGAGTCATCAGACAGCAGT
GATGGAGAGGTGCCCACAGCTGTGGCCCCGGCTCAG
gtgaggccccttcctgtaaggctctttctttttcccccccactcagagtggagctgcctg
tggcctcccaacctcacactgggactctgtctacaatcttagtttcttaatgtctgcaca
cacctaccctgggctccctctcccgatcctgtgtatctcactccaggaaaagtccttggg
EXON 11  189 bp
tggccccggctcaggtgaggccccttcctgtaaggctctttctttttcccccccactcag
agtggagctgcctgtggcctcccaacctcacactgggactctgtctacaatcttagtttc
ttaatgtctgcacacacctaccctgggctccctctcccgatcctgtgtatctcactccag
GAAAAGTCCTTGGGGAACATCCTCCAGGCCAAACCCACCTCCAGTCCTGCCAAGGGGCCC
CCTCAGAAGGCAGGGCCTGTAGCCGTCCAGGTCAAGGCTGAAAAGCCCATGGACAACTCG
GAGAGCAGCGAGGAGTCATCGGACAGTGCGGACAGTGAGGAGGCACCAGCAGCCATGACT
GCAGCTCAG
gtgaggcctggggaaggaggctgctacatggcctgatctgccacaccacagtcagcaccc
ccggggagctgtgctccctcaggcagagcatgggttttggctggtggggcagaacagatg
ggggactctgagttcaggaaccttctccagcctttctttggtgtcccctcaggcaaaacc
EXON 12  249 bp
cagctcaggtgaggcctggggaaggaggctgctacatggcctgatctgccacaccacagt
cagcacccccggggagctgtgctccctcaggcagagcatgggttttggctggtggggcag
aacagatgggggactctgagttcaggaaccttctccagcctttctttggtgtcccctcag
GCAAAACCAGCTCTGAAAATTCCTCAGACCAAGGCCTGCCCAAAGAAAACCAATACCACT
GCATCTGCCAAGGTCGCCCCTGTGCGAGTGGGCACCCAAGCCCCCCGGAAAGCAGGAACT
GCGACTTCTCCAGCAGGCTCATCCCCAGCTGTGGCTGGGGGCACCCAGAGACCAGCAGAG
GATTCTTCAAGCAGTGAGGAATCAGATAGTGAGGAAGAGAAGACAGGTCTTGCAGTAACC
GTGGGACAG
gtgaggcctgtgttttctgggcgggcctcagggccgcccctacgtggtcctttggactcc
tggagacacctctcttccccttgtcatcccaggcaaagtctgtggggaaaggcctccagg
tgaaagcagcctcagtgcctgtcaaggggtccttggggcaagggactgctccagtactcc
EXON 13  198 bp
cacccagagaccagcagaggattcttcaagcagtgaggaatcagatagtgaggaagagaa
gacaggtcttgcagtaaccgtgggacaggtgaggcctgtgttttctgggcgggcctcagg
gccgcccctacgtggtcctttggactcctggagacacctctcttccccttgtcatcccag
GCAAAGTCTGTGGGGAAAGGCCTCCAGGTGAAAGCAGCCTCAGTGCCTGTCAAGGGGTCC
TTGGGGCAAGGGACTGCTCCAGTACTCCCTGGGAAGACGGGGCCTACAGTCACCCAGGTG
AAAGCTGAAAAGCAGGAAGACTCTGAGAGCAGTGAGGAGGAATCAGACAGTGAGGAAGCA
GCTGCATCTCCAGCACAG
gtgaggcctagaaggagcaggcccatcccacccacacctgttcctgagccagggctgagg
atgggcttgactgggggctagtgttgcctgcaggtgtgcagaagcctcagaggtagcctc
aacacagcttccttccctatctttcactccatgtctcctctgcccatcagagctccaggg
EXON 14  138 bp
catttgatagaggactgaactgaggcccagtgagatcaagtgatgagctcaggttcacac
gcctattgcatggaggagccagaatccagactcgggctccagctccagagtctgtattct
tggctagctgctttactcaatctcaccttctccctccttaattcccttttctccactcag
GTGAAAACCTCAGTAAAGAAAACCCAGGCCAAAGCCAACCCAGCTGCCGCCAGAGCACCT
TCAGCAAAAGGGACAATTTCAGCCCCTGGAAAAGTTGTCACTGCAGCTGCTCAAGCCAAG
CAGAGGTCTCCATCCAAG
gcaagtggggccagaagccacaggaggtgtggagggttggggtagagaggaggaccagtc
actgagcccagccaggagaaggtgcgtgcatgggcaggccacccacccagagttgtgcca
tagtggggagtgggacctgaaaggaatcacttttgcctccaatactattatccccctgca
EXON 15  180 bp
ggggccagaagccacaggaggtgtggagggttggggtagagaggaggaccagtcactgag
cccagccaggagaaggtgcgtgcatgggcaggccacccacccagagttgtgccatagtgg
ggagtgggacctgaaaggaatcacttttgcctccaatactattatccccctgcaattcag
GTGAAGCCACCAGTGAGAAACCCCCAGAACAGTACCGTCTTGGCGAGGGGCCCAGCATCT
GTGCCATCTGTGGGGAAGGCCGTGGCTACAGCAGCTCAGGCCCAGACAGGGCCAGAGGAG
GACTCAGGGAGCAGTGAGGAGGAGTCAGACAGTGAGGAGGAGGCGGAGACGCTGGCTCAG

gtgagggggagggaatggagatcatcccctacatgggatgtaacacctttgccacatcca
gctcctgtcttctcacacgtccaccctccaggctctctcctctcatcctgtttctccctc
caggtgaagccttcagggaagacccaccagatcagagctgccttggctcctgccaaggag
EXON 16  201 bp
tcagggagcagtgaggaggagtcagacagtgaggaggaggcggagacgctggctcaggtg
agggggagggaatggagatcatcccctacatgggatgtaacacctttgccacatccagct
cctgtcttctcacacgtccaccctccaggctctctcctctcatcctgtttctccctccag
GTGAAGCCTTCAGGGAAGACCCACCAGATCAGAGCTGCCTTGGCTCCTGCCAAGGAGTCC
CCCAGGAAAGGGGCTGCCCCAACACCTCCTGGGAAGACAGGGCCTTCGGCTGCCCAGGCA
GGGAAGCAGGATGACTCAGGGAGCAGCAGCGAGGAATCAGACAGTGATGGGGAGGCACCG
GCAGCTGTGACCTCTGCCCAG
gtaagacttgccaggcctctgagccaccaacactcactcctcagaacgggggtatagggc
tgggcgtggtggctcacacctgtaatcctagcactttgggaggccgaggcagatgtatca
cttgaggtcaggggttcaagaccagcctggccaacatggtgaaaccccgtctctactaaa
EXON 17  187 bp
ggtcttagcagatgtgtggggtgggagggggcaccctgggcagctggaatggcttctgtg
cccagctgcccctgagctcagtggaccctttgccttgtaaaacactccctaaccccatca
cctcctttccctggccaagcctttaatcactgggggggtgttttgtttttgtttttcaag
GTGATTAAACCCCCTCTGATTTTTGTCGACCCTAATCGTAGTCCAGCTGGCCCAGCTGCT
ACACCCGCACAAGCCCAGGCTGCAAGCACCCCGAGGAAGGCCCGAGCCTCGGAGAGCACA
GCCAGGAGCTCCTCCTCCGAGAGCGAGGATGAGGACGTGATCCCCGCTACACAGTGCTTG
ACTCCTG
gtgagcgcagcccttatgcagtggtgggaggggctgccagcactgccccacattgaggcc
cagaagggacaggacactggctgagtcacatagcaaggtgttggtcgggaggggcttggg
gtcaggtctctgggccctgcattagccattctgattagggcctggctcagacctgcagtt
EXON 18  137 bp
gacataatgacatctcctgcctgggaggcttggagagggaagtaaacaagcttctacctc
tgtaagccctgagcacagctctagatcaccagcacaggccggtaaattgggttattgccg
ctgctgaggaggcgatggggcttttgtgccctgatgtgcccccatctcgctccatttcag
GCATCAGAACCAATGTGGTGACCATGCCCACTGCCCACCCAAGAATAGCCCCCAAAGCCA
GCATGGCTGGGGCCAGCAGCAGCAAGGAGTCCAGTCGGATATCAGATGGCAAGAAACAGG
AGGGACCAGCCACTCAG
gtacctggtgggcaagggagggtaatgcaggccagtggggtggggccctacttccatact
tacccacatgtgctgatgggatggcctgcaattgctgtcacgcccacactccagaggtcg
tggcctcacagccagaggctttctggcctcctagctacaaccccccaaatcacctttgag
EXON 19  114 bp
gctccttgagaacaatgtgattcgctcataacctgaagcctgccaccagttttgcccctt
tgactgcccctcagtccctgctccagccctcaccccagccagacagcatctgaccagggt
gtggcacagctggcatcccaaggacttgtgagtctgagggctacctcttgccacccacag
GTGTCAAAGAAGAACCCAGCTTCCCTCCCACTGACCCAGGCTGCCCTGAAGGTCCTCGCC
CAGAAAGCCAGTGAGGCTCAGCCTCCTGTTGCCAGGACCCAGCCTTCAAGTGGG
gtgagcttggggagccaggggaagcaagcccacggagcgtagaaggtgcaggcgtggccc
tgcatcgcggcaccagcactcatctgccccatgacctctgcacttggtttgcctccctcg
gcctcagtggcctaatctgtaagaaggaattacagtacctttcgtagttggaaggatcaa
EXON 20  220 bp
ggcctcagtggcctaatctgtaagaaggaattacagtacctttcgtagttggaaggatca
aatgaggctgcatgtgtgccccatctaacacagttcctggccctactgaagtgttcagga
aggaccaggtcttacttgccctaatttttccttccattccttctcctttcaccgaattag
GTTGACAGTGCTGTGGGAACACTCCCTGCAACAAGTCCCCAGAGCACCTCCGTCCAGGCC
AAAGGGACCAACAAGCTCAGAAAACCTAAGCTTCCTGAGGTCCAGCAGGCCACCAAAGCC
CCTGAGAGCTCAGATGACAGTGAGGACAGCAGCGACAGTTCTTCAGGGAGTGAGGAAGAT
GGTGAAGGGCCCCAGGGGGCCAAGTCAGCCCACACGCTGG
gtgagggtgccaggggaaaggcaagggtgggccaggaagagggtgttgtgtggcctggtg
gagccatagctctggcctcagctccatatctcagactcattctgcacctgtggctgagcc
tgggcctcagtttccccacctgtacaacttcatgaggaagtcaatccaaatgatttcaga
EXON 21  83 bp
tgtgactagcgataagtgtgcaaggagtgttgaagcagtaggaagacttgtggtgaggcg
gggcaggggatgggggtgagggacctgcagagagaccagggccttcctgaagggctctgc
ccttcccggctggcaggggccacctggggctaccaacaggatactgtgcttctccagtag
GTCCCACCCCCTCCAGGACAGAGACCCTGGTGGAGGAGACCGCAGCAGAGTCCAGCGAGG
ATGATGTGGTGGCGCCATCCCAG
gtaactgcaagggagaggactggcagcccataggccttagggtggagccccaggccaggc
tcctgtctacccgatccctcaggtcaggggtctgggtcccctctcttcacagaggccttg
ggcaaggtcctgtctgcaaggcaccacgtgtggcccagccagcagaccacagccaggctg
EXON 22  181 bp
gaggcacacgccaagggctgaagtgctgctctgtgccttgttgtccacccactctgcact
gatagggcagggtgatcctagaggccccaggctgctttcctcacagcaggccatgactcg
ggctgggttatggcagtggggtggggtggtggcagcctctttcacaatgggcttcttcag
TCTCTCCTCTCAGGTTATATGACCCCTGGACTAACCCCAGCCAATTCCCAGGCCTCAAAA
GCCACTCCCAAGCTAGACTCCAGCCCCTCAGTTTCCTCTACTCTGGCCGCCAAAGATGAC
CCAGATGGCAAGCAGGAGGCAAAGCCCCAACAGGCAGCAGGCATGTTGTCCCCTAAAACA
G
gtaagttaaggtctgcaggagggacatagcaggacacagagggacagggcagtgggcccc
ttcttgccctcctgtagcaacagtcctcccaacatggtcctgtctgcccccagagcctct
ccaagtgagaccttgtggccttgcattggacctgaagatgctcatcaaagtgcaggtggg
EXON 23  561 bp
gtggaaaggtgtgagcttaggagaccagctggggcagagtgaccgccaagccttgctctc
cccatctgtgccattgtaagaaaagatggagtcactccctgcaccctcttcgctcttagg
taccataagatctgtcccccaactctcccagatctgtgaccccacattctctctccatag
GTGGAAAAGAGGCTGCTTCAGGCACCACACCTCAGAAGTCCCGGAAGCCCAAGAAAGGGG
CTGGGAACCCCCAAGCCTCAACCCTGGCGCTGCAAAGCAACATCACCCAGTGCCTCCTGG
GCCAACCCTGGCCCCTGAATGAGGCCCAGGTGCAGGCCTCAGTGGTGAAGGTCCTGACTG
AGCTGCTGGAACAGGAAAGAAAGAAGGTGGTGGACACCACCAAGGAGAGCAGCAGGAAGG
GCTGGGAGAGCCGCAAGCGGAAGCTATCGGGAGACCAGCCAGCTGCCAGGACCCCCAGGA
GCAAGAAGAAGAAGAAGCTGGGGGCCGGGGAAGGTGGGGAGGCCTCTGTTTCCCCAGAAA
AGACCTCCACGACTTCCAAGGGGAAAGCAAAGAGAGACAAAGCAAGTGGTGATGTCAAGG
AGAAGAAAGGGAAGGGGTCTCTTGGCTCCCAAGGGGCCAAGGACGAGCCAGAAGAGGAGC
TTCAGAAGGGGATGGGGACGGTTGAAGGTGGAGATCAAAGCAACCCAAAGAGCAAGAAGG
AGAAGAAGAAATCCGACAAGA
gtgagtgaccgcttctcccagcccaccccaagggctgctgggcaccccacgggggcggga
gggaccctcagccagcacctggtctcattcctcccatgtagaaaagagaggctgagacca
gcctggccaacatggcaaaaccccgtctctactaaaaatacaaaaaattagctggatgtg
EXON 24  98 bp
agcctcccaaagtgctgggattgcaggaatgaacctccacgccccgccctgctggcctgt
tgtgatggcttctggtggtgtggggaaagctgggagccctgccctgtgcacctcccaaca
ttgaccccagcacttaggattaccatctgttgttcaggaactttactttacttcccttag
GAAAAAAAGACAAAGAAAAAAAAGAAAAGAAGAAGAAAGCAAAAAAGGCCTCAACCAAAG
ATTCTGAGTCACCGTCCCAGAAGAAAAAGAAGAAAAAG
gtagagagttcctggggtgtctcaggccagaaaacagacccaaacccaagccccctccta
cacacccagacctggttcctgcccccttcccattttcggggcccagtcgggggcgtcagg
ggttgtgacacaccagggaagaggctggcagggcatgttccctgagcacatggaagccgt
EXON 25  49 bp
tggccagcagggcctcagctgtatttaggagagctgaacatctgtttgcctctgcccttg
gaggtcgctgcagacccagtatctattctaggggaattcactagtcctcaggaggtgggg
gcagcagtgggtggggaaaagctgcaggtctgagagcctctcgtacttccctcctcacag
AAGAAGACAGCAGAGCAGACTGTATGACGAGCACCAGCACCAGGCACAG
gtacgcttcccaatcattcctgagcattcagggtgggaggacagctctggtgtcccctgt
ggtcccagagagccaggcagacctgataggtgggctctaaggggaaaggaggctggggaa
agaggttctgttgccaagggtccatggggccactggggtgacatcaggagctggcactgc
EXON 26  483 bp
cttatgtgaagctaaactaaacactaaaggactcagcccagttctcagaacattccaagt
gctaaaaaatgtccactgtggttaatgcctcccccctgcattggagatgccagatttcat
tttccttgcaggggaaaagggtcaggaaatttgacatctgcatgtgtttccttcccctag
GGATTTCCTAGCCGAGCAGTGGCCATCCCCATGCCTCTGACCTCCACCGACCTCTGCCCA
CCATGGGTTGGAACTAAACTGTTACCTTCCCTCGCTCCACAGAAGAAGACAGCCAGCTTC
AGGGGTCCCTGTGCTGGCCAAGCCAGTGAGCCTGCGGGGAGGCTGGTCCAAGGAGAAAGT
GGACCAGCTCCCATGACCTCACCCCACTCCCCCAACACAGGACGCTTCATATAGATGTGT
ACAGTATATGTATTTTTTTAAGTGACCTCCTCTCCTTCCACAGACCCCACATGCCCAAAG
GCCTCGGGACTTCCCACCACCTTGCTCCACAGATCCAGCTAGGCCTGACCTGTGCCTCAT
CCCGTGCCGCTCGGTCTCTGGCTGATCCCGAGGCTTTGTCTTCCTCTCGTCAGTTCTTTT
GGTTGTGTTTTTTGTTTTTTTTTTAATAACTCAAAAAAAAAATAAAAGACTTGGAGGAAG
GGT
gcaagctcccagtgcatctggggcacatgtttcttggaagggactgtctcgccgacactc
gggattccctcttgcctgcatgttgaggctatgggtgaccgtggttagtgggacaggcag
tgagcagtgaagtgcctgagtgccgaattggtggggaaggcttcctggatgaggtggcat