Gene SSBP2 Variant 1
DNA : 331.16 KbNT_006713
mRNA : 1710 bp NM_012446
CDS : 1086 bp NP_036578
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  120 bp
gggaaggagggaggagactgccgctgaggcttagccgccaccgcgcgcttcggaaggcca
gagggagggggaggcctgtcagtctcgcgcgttgcctgggcgaagggggcggagctttgg
cgtggggcggccaatagtgggggtggctgcgtgggtcgccatggggacggggctgttccc
GGGGAGGCTGTGATGGGTTGACAGGTGCGTGACAGTGGGAGCTGCTCTCGGCACAAGCAT
GTACGGCAAAGGCAAGAGTAACAGCAGCGCCGTCCCGTCCGACAGCCAGGCCCGGGAGAA

gtaagtgtctccgcttctcacccacctccgccttcacacgcgcgcacactcacgcacgca
ctcgcacactctgggagacacagacactctccgcccggggagcgccgggggtgggctggc
agggggaggggtgccgcgatgggggcgtgtggtgcggggagctgcgctttcccgggaggt
EXON 2  73 bp
actttaagttctttctgaacatacatgtattattaataattcctattgaaatagtatggg
aagggtttatttttggtcactgttagtgtgtaagatatttcagcaatggaaagatgtgca
ttatttaaagaatgaattttaatattcctcttctcaataaatattttatttgttttccag
GTTAGCACTCTACGTATATGAATATCTGCTCCATGTAGGAGCTCAGAAATCAGCTCAAAC
ATTTTTATCAGAG
gtatgttttatatattttctgtattgcattttgatcttatataaatgaatggaaaacaca
ctataataattatttgaaaaaagtttgttatgtattatatagtgaattcctagttatccg
tatacatagtatagtttttatagattatgtataagcatttttatccccatgccacttctg
EXON 3  62 bp
ctaatccagtcaacaaatcacttgtaaaatgagtacttgcaaaacttgggtaaaaaatat
catgaaaatgatgaaaaattcaaatattactatagtattttaaatggggatattattact
ttgtaatatgtgtggaaaaaagtattattaggaaagtaatatctcttttattcattttag
ATAAGATGGGAAAAAAACATCACATTGGGGGAACCACCAGGATTCTTACATTCTTGGTGG
TG
gtaagtatcctttattccatttttactggcttgatgatgcatttcaataggcctgtacta
tacctgtttatgatttcatgcttcctttttattttttcattttctaaaattttctggaag
gtagcactttttaaaaaacccttaaaaaccagcactagtgtaatttaacttaaatatact
EXON 4  85 bp
tagatggtaacactgttattgcatgaagagccttgcttgcgtttaagtctttcagataga
tatctgttctgaagacaaaacattttgtataaagaaaaacatgtcttctacttttggaat
tgtgatttctcatattggtgttgtatgattttcttaatgttaccatgattacttttttag
TGTATTTTGGGATCTCTACTGTGCAGCTCCAGAGAGACGTGAAACATGTGAACACTCAAG
TGAAGCAAAAGCCTTCCATGATTAC
gtaagttaacatataattttacaaagttacactgtcagttttctgtttaaccactgctct
taaaaaatacactggctcatctattcttttgttttggtacttaagaaattgtttggtctc
ttttttcttgaaaagtaggttcataactttaaatgtgaaatagaaaggggcatttgagtc
EXON 5  90 bp
taatttaaccagtcatatactaaactgttgtatctcagtttacttctaggatggggaaaa
ttaccagtatttgttcccaggcatgaaagagcatcccgtcctgcaatctattatcattag
tctttggttttgtgccttctctgtaatgatataggtttgtttctcctttattctttgcag
AGTGCTGCAGCAGCTCCCAGTCCAGTGCTAGGAAACATTCCCCCAGGAGATGGCATGCCA
GTAGGTCCTGTACCACCAGGGTTCTTTCAG
gtactcagagaaactctgactaggaatgttaaagcataggaactcctgtttgattttatt
aaagatacgaaggaagataaggctattttaatttttaaggtaaataataatgtgtagcca
actcttgattattcagatgggttatctattatatccctttcttcttatgttttatttgtt
EXON 6  60 bp
caaaataagtaatgggatggtaatttttcttaaaagcatttattatgctgaaagcagcct
caaagtacattgatttgtgatttgattaattctaaaattttttaagtagtttattttcag
atatgtattttacattgtactgttttttgttttgtttgtttatttgttttacttcaatag
CCTTTTATGTCACCTCGGTACCCTGGAGGTCCAAGGCCCCCATTGAGGATACCTAATCAG

gtaagatttatgtgctatgtaagttttttgtaagaatcaaagatcttgaaaatgtcacat
atatttatcatcctgtaaaaatatgaaattctcctttttctgtcccatttaatgctattt
ctagtctgcttcaagggttggcaaactacagctcataagctagctattttttataaataa
EXON 7  67 bp
acttatttaaggtatataaacctgcaaaacttataaatgaatgtgaaatataagaaatct
tgagaaatactcaaatgcattcttgtaattatcatacaagcatttaaaaggaaattgtta
aaaaacttattttataaatatttacaatattgctctttatttttcttaataaattgctag
GCACTTGGAGGTGTCCCAGGAAGTCAGCCATTACTCCCCAGTGGAATGGATCCAACTCGA
CAACAAG
gtgactactctaaagtaaaaggaaaattgatgtgcagaaccatagaggaaatcttttatc
tcttaaggaaaattgtatttgtataagtaaatctcctatagttataccagttgcattttt
ctaagtaacatagccaaatgatttatatttccagctcacttaattatgcatgatagtgag
EXON 8  71 bp
tagagggtgtgggtaggtagtggtaagaggtggaaaagtggtctggaagccaaggtaaga
tggtgtcagtactcagactcttggtaaatgagacagtaacacccaggagggaggaagctg
ctagcctctggtttagtactcatgctcattactttgctaatgtcttcatactttttttag
GACATCCAAATATGGGTGGGCCAATGCAGAGAATGACTCCTCCAAGAGGAATGGTGCCCT
TAGGACCACAG
gtaaataatcagtgcatatttacaatagcaaagatatggaaccaacccaaatgcccatca
atgatagactgggtaaagagaatgtggtacatgtataccatggaatactatgcagccata
aaaaggaatgcgattatgtcctttgcaggcacatggatgaagctggaagccatcatcctc
EXON 9  68 bp
agtaattgctaaaatagaagcaaaaatacaagaatggacccctcagagaatgaattacac
aggccttatccaattggagttatgtagggaaatcattaacgtgctctcctttctttcccc
cctcctctttggttttgtttttttgttttgtggtagtctgacccttggttatcattacag
AACTATGGAGGTGCAATGAGACCCCCACTGAATGCTTTAGGTGGCCCTGGAATGCCTGGA
ATGAACAT
gtaagcaatgttatatcatatactacattattacgtggatgatattttatatatataaat
aataccatattattctatttagtaaagtgttctattttctggcctctaaaatgacgttaa
tttgtaaaacaatttgagcaccacagtctctgtgtggtataaaaatgaactaaacaagag
EXON 10  49 bp
ttttgggggacttaattaatataaaaagctattaaaataaatataaagagagtaatttca
gtgccaaactagaactgcatagtaactgaattataaatgttatattttatgatttgtcat
tgattattgtgaaaccttcaaagcataggttaaaatttcatttatcaaattgttttgtag
GGGTCCAGGTGGTGGTAGACCTTGGCCAAACCCAACAAATGCCAATTCA
gtgagtatatatatatattttttttaatattttgcattttgtaacatttaacaaaaatca
caaaaacattttgcttttgaaagctttgcaattggttgtagtaacccttttttaagtaat
cattcaaaaagtttaatataaattttagaaaaagatgcataattttttgaaattatgtaa
EXON 11  36 bp
aaatccaagttattattattcagttttccagtacttaaacagatacaaatttttttatcc
tttactatactttgtgatacattttaaaacttgacaaaaaatcatgaaataaattcattt
taggtcagtgtccatattgctacatgaatcaaaaatttttttgtcctattcgtgttccag
ATACCATACTCCTCAGCATCTCCTGGGAATTATGTA
gtaagtacatttgggtttgtttgcttataagaattgatgttacattttatttgggcaatg
aaacagttgtccagatgttaagaagagcccctgtgtattggccaagaagtgaacatcttg
agttgtttcatctgccaacctcagtacatatgttgatgttcattagtgaaacagttatca
EXON 12  55 bp
atatttaagctaaattatgttttgtagaatattgaaatgattgtgcagtcaaagaaaata
aattagagaaaatatatttctgctcttattttcaaattggattattatagatataagtct
aacttctgttttttcttatgcaatgccttatttttactgaaattttgtataattatttag
GGTCCTCCAGGAGGTGGAGGGCCACCAGGAACACCCATCATGCCTAGTCCAGCAG
gtattgtaatcaaactagccacatgggcatttgattattagaataaaatcacagaatata
gaaattgttcatgaaataaagttagtagtattcatgttctcacgatagttaaaggagtag
aggcagcatggtaggaagaaatatagtgttcttaaataagtattatccagttaagcattt
EXON 13  71 bp
aatgacaattttggggtcagaaaatgactgtgggtatttatttttagtaatgacaatttc
aagtgttgcagcttatatagagagaggtatctgtatgcaaaccatctttgatcattactt
tgtgatgaattgggtatagactctaaagaaatattttaattaagtaatattttgtttcag
ATTCAACCAACTCTGGTGATAACATGTATACTTTAATGAATGCAGTACCTCCTGGACCTA
ACAGACCTAAT
gtaaatatgaactttttttatttttggaatgtatttgaagactttcaaactctgagtgca
ttccatgtcctgtatattgtttaaactttatattttattatccaggagcttattagatat
tcaaaaagtcaaattcttttctctgagctgggttaaaaaaacagtaaacatatataacag
EXON 14  79 bp
gagaggtgaacagtccagttagagaatccacaaggctgaaaaacatcaagtaaaagatct
ccatagcttgaaagtaaaaataagttgtggcagtgtcttgtaatgttaaatatattgtaa
aattgagataagccattgttttcagtatgattacagtgattttcttcatttttaaaatag
TTTCCAATGGGTCCTGGGTCAGATGGTCCCATGGGTGGATTAGGAGGAATGGAGTCACAT
CACATGAATGGCTCTTTAG
gtaaggcttttcaatttgatgtttagaataaattcataacaaaaccttaattctacctag
tgcatattacagtttccaaagttcttccatagccagctactcatttttaaatacttcaac
ttttacctcatacagatagtttaattgacattttattggttataactgtagatcacttga
EXON 15  29 bp
tcagatggtactgattcactatactgtataaaagaagaggaattttttcagatttaaaaa
ctcaggagctatatgctggaaaatacatatagtatacttcacttatttaaattaaaggag
tgtttaatttataaatgaaatcttacctaataaaggctttctttttatattttgtttcag
GCTCAGGAGATATGGACAGTATTTCCAAG
gtgagtgctgtgtattctgtgttgtttttaatcagaattttatttaacatggaactcatt
aaaattattagagtaaatttacgaattttgttcttgaacaagagtttgaaagtagaagac
caggtataattaattggaagttaagaatattaatgcatattatctgtgggaaagggtaaa
EXON 16  99 bp
ggaaggcattagtacttgtcaaagtgcaaagaatgaaatagaatacatggtagaagtcta
agattaaaattagaagtatgctttgtccttagggatgctgtttcaatattcgaaacagta
cagtgcaagagggaaattaaaattttcaacaatgccttgttttctaaatcttgtttacag
AATTCTCCCAATAATATGAGCCTGAGTAATCAACCGGGCACTCCAAGGGATGATGGCGAA
ATGGGGGGAAATTTCTTAAATCCTTTTCAGAGTGAGAGT
gtaagtattcccttgactatattatactcaaattttatttctgaagctcttctgctagaa
taaatgcataaagccacttttactgctgtttatctagagttcaacaggtttatcttttag
ataagagaaactttaagtggaatatctttgaaaataatttttaaaacaaactttttcttt
EXON 17  596 bp
aagttaagtctgtatcattttactttttttatagtttcttattttatgttgtatgagatg
aaaagcttgcacataaaagatgataagaaattagaattcatcgtttctgttgtaccaaga
agaaccttagtgatctctaaaagaattgttgttaaaatatggattcttctttccttctag
TACTCCCCTAGCATGACAATGAGCGTGTGATCCATTACCAAGTCTCCTCATGAAAACCAC
AGTGAGTCAGCCCTTCACAGAACTACTACGGAAGAAAATTATTCATCACAGTGTACAGTT
AAACAAAGGAATCTCAGTCACACCAAACCAACCTTTTTATTTCCTGCTCTCTCCCCTCTT
TTGTGAAGAAAGCGGGTCCAAATGTGATTCAAACAACTGTACGGAGTGGCATATTAGAAT
TGCCCTAAACTGAACTGCAAATAATTATGTGTGTATGTATATGTGTGGGAAAGAGAATGT
ACTGTATATGTGTATGTTATACAGACATATACACATACATACATTGACCCACAGGACATT
GTAAAATATTATCACATGACATCTTAAGTAGAAATAAGTAGGGACTTTTATTCCATCCTT
TTTTTCACGTTTACATTTTAATTATTACAAGTTGCTCCTGCCCCCTCCCTGAACTATTTT
GTGCTGTGTATATCACTGCTTTATATAAGTTATTTTTTAAGGTGAACTCAGATGTTATGG
TTTTGTAAATGTCTGCAATCATGGATAGGAATAAAATCGCTTATTTGAGAGCTTTC
attaaattgcgtctgatgcaagttatcctgtgaatcacaaagtgtactgtctcaaaaaat
agaagaaaatgtgtcttcgtctttatgttgaatcaaacaatttctcagttaccttcagtg
aaaagtatttttttaatttttatttgagaaaaacacttcaaatcagtaaaagcttaactg