Gene SPRY4 Variant 1
DNA : 14.56 KbNT_029289
mRNA : 4923 bp NM_030964
CDS : 969 bp NP_112226
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  158 bp
agatcttttcccgccccccattcataaaaaaaggagcggagcgcatgcgcgctcagggtc
tgttgtgcccacccattcatagaatcgcgaacggcacgcgtgcgcactggcgctcccttc
cctcccattcataaaaaagccattttcccaggcagtggttgcaacatcgccgcggaggta
GCGAGCTGAGCTGACAGCGCGGAGCTGGCGCTGTGGAGCGCAGGGAGCCTTGCCGGTTCC
TCCGACCGGCGTCTGCGAGTACAGCGGCGGCTAACCTGCCCCGGCTTCAGGATTTACACA
GACGTGGGGCGATGCTTGTGACCCTGCAGCTCCTCAAA
gtaagtccatggctggtttggagatctgaaactgcccctctctgagccgcgacgcgactc
cccccttgggctggggcaaatggtgcgctatttctaggcgcgcctcagtgttccttccct
cagcctgcgcctccttgagtcgctgcggtgcgccgcagctccctgacgccctcggcccgg
EXON 2  51 bp
cacagcctcttgccagtttgtcattagctgacctgtagctttcaaagtacaactgtcagg
ttttcccaatatttcccaactcacctccctagggtaagtcaaggggagggtgtgggtggg
tgggattaggcatcctgctcaattgtgcggacatttaacatgcctcttgattcttttcag
CCAGCCTGTATTGAGCGGTTTGCAGCCTGATGCTCAGCCCCCTCCCCACAG
gtacaaatgcagtgagtgtcagactggctggttctgggctcccagacccgccaagcagca
aatacagtgttgcgcgtgttctggggattttgatatcctgctgattcagtattctaggac
tctctgtgccctggctccctcccttcctcacagacctgggccagggaccccatcaatgaa
EXON 3  4714 bp
gacttcttgtcattattaatcatcttaagcttggggagtcactggaaagtccacagaggg
attttagttcctatgtcaattgggcggctcccaaggacctgatggggggtgaggtattgg
caggccacatactgatgcctggaatccattctctcttccttttccccaccccacccccag
GGCCCCTAGAAGCCTGTTTCTCCGTACAGTCCAGGACCTCCAGCCCCATGGAGCCCCCGA
TCCCACAGAGCGCCCCCTTGACTCCCAACTCAGTCATGGTCCAGCCCCTTCTTGACAGCC
GGATGTCCCACAGCCGGCTCCAGCACCCACTCACCATCCTACCCATTGACCAGGTGAAGA
CCAGCCATGTGGAGAATGACTACATAGACAACCCTAGCCTGGCCCTGACCACCGGCCCAA
AGCGGACCCGGGGCGGGGCCCCAGAGCTGGCCCCGACGCCCGCCCGCTGTGACCAGGATG
TCACCCACCATTGGATCTCCTTCAGCGGGCGCCCCAGCTCTGTGAGCAGCAGCAGCAGCA
CATCCTCTGACCAACGGCTCTTAGACCACATGGCACCACCACCCGTGGCTGACCAGGCCT
CACCAAGGGCTGTGCGCATCCAGCCCAAGGTGGTCCACTGCCAGCCGCTGGACCTCAAGG
GCCCGGCGGTCCCACCCGAGCTGGACAAGCACTTCTTGCTGTGCGAGGCCTGTGGGAAGT
GTAAATGCAAGGAGTGTGCATCCCCCCGGACGTTGCCTTCCTGCTGGGTCTGCAACCAGG
AGTGCCTGTGCTCAGCCCAGACTCTGGTCAACTATGGCACGTGCATGTGTTTGGTGCAGG
GCATCTTCTACCACTGCACGAATGAGGACGATGAGGGCTCCTGCGCTGACCACCCCTGCT
CCTGCTCCCGCTCCAACTGCTGCGCCCGCTGGTCCTTCATGGGTGCTCTCTCCGTGGTGC
TGCCCTGCCTGCTCTGCTACCTGCCTGCCACCGGCTGCGTGAAGCTGGCCCAGCGTGGCT
ACGACCGTCTGCGCCGCCCTGGTTGCCGCTGCAAGCACACGAACAGCGTCATCTGCAAAG
CAGCCAGCGGGGATGCCAAGACCAGCAGGCCCGACAAGCCTTTCTGACAGTTTGTGTCGA
AGCCCCAGTGCTCTGCCTGGAAACCTGGTTCTCTTCTGACATCTAAGAAGACTGCAGCAA
GGTCAGAGGTTTTAGCCTCCTGAGGCTGACCTTGCTAGTCTGCCCACTCCCTACCCCCAG
CTTCGGAAAATACAGAGACCACCACCACGTACCCTGTATTCCCCAAGGTGATGAAGAAGC
ACTTTGGGGCTTTTTTTCAGGGTCCTGAAACTTTGTGTCAAACAGACAATGCAGGGGCAG
GGTGTGGTTTGGGGGGAAATTTTTCTTTTTCAGAAGACAGAACACAGATGTGGACACATA
TCCGGAAACTGCAGCTGCTTGAATGCCTTCCCAGCCCCTCCTTCTCCCTCCCTCCCTCCG
CCCCCCCCCCCTTCCTCTTTTCCATTGTCTTTGGCTCTCACAGGAGCTAGCTGCCTGGGA
GGAATTGTTAACTGAGTACCAGGGTACCTTTAAAGAAGACCCTTGGAGTCTTCTATACCT
TCTTCTCCTTCCCCATCTCACTCCACCCCACTTTGTCCCTGATGTCTTGGGGAAGGTGTA
GAACACCCTAGCAGTTCCTATTGTATATACTTGGGAGCCACTGAGAACAGAGGACGGCCA
GTGAGTCCAAGCCTCGTTCCTCCTTCTGCCTCCCCGGAGCCACAGGATGGATTTAGGAGC
CACTGCTCAGTGCACTTCTCCCTTCCAACTGCATCAACTAACTCTCGGGGGTGTTCTGCT
CACCACACCGTCCTTCGGTTCTTACTGAGTCACAGACTCGCCTGCCCACTACGTGTCCTG
GGTTCTCTCTACTCAGATCCCTTCCAGAAACTTTATATGGGTAGAGGAAGCCAGGGCGGC
AAATGCGAGACCAAATATCATTTTGCCAATGAGTCTGAGGCTGTGGTCTCTGGATCCAGT
CATTATGTTTTTATAGAATAATTAAACCGGATGCTAACGGTGTTTTAAAAAATAATAATA
AAACAACTTGTTTCCTTTTGGCCACCCCCAGGAAGGGCTGATTTCAAAATCTGGGGGCGA
GCAACCTCAAGGAACACAATTTCCCTCCCTATCAACAAGAGGATTTTAACAGCAAAGAAG
AGAGGCAGCACCTCCCATTGGCAGAATGACCGCTGAGCCAGGCTGGGTTTGGGTTTCTTC
TCTTCTGATTCTGCTGCTCACTGTCATAGCCTTTTGTGTATAGTGATGTGTCTGTATCTT
TAATGTAAATAGAGAGATGATGAAAAAAGAGTCTATTTTAGTGTTAGGAAGCCCCAGCAG
GGGAGTCGGAAGAGCTTGGAAGAGCTGGGGAGAGGGTAGGGGAAAGGTTTTTCCAGGGGC
CACTGGGTTTGAGCCCTGCTTCTGTGCACAGCCACACCACCCTCTCCCGACAGCCCTCAA
AGACGTAGCAACTCTTTCTCTCAAGGTGCTAAAGGACTCAGAAGGTGCAGCACGTCCAGT
GGGTAGGTACTTGTTGCATGCAAAAGCTGTAGTGTATCTGGTCCTTCCTCCCCAGCTTTT
GTGTGGGGTTCTTGCTTTGTGTGGTATTTTGTTTTCCCCTCTAATGAGAGGGCATGGCCT
GAGTCAGAAGAGCTACCCCAGGTGAAACTGGAAGTGCATGAGGCAGAGCGTCCGTAGCAT
TTCCAGTTTGTTCTGTATAGGAACAGAGGTGCCTCCGGGAAGGAGGCAGCGAGGTAGGTA
GCTATGATAGGCACCTAATGCTTCTCAAGGACTTATTTTTTCCTTCTTGAAGACTAGTAG
TAACATCTTATGATTTAGAGTAAGTTGATTGTAACCATAGGTATTTATTGATTGGAGGAA
GGGAGGGTCATATTATTTTCGGCTTTATTTATGTAACATTTGCTAGCTTGTAAAAGGCGA
ATGTGAAATATTGCATCTGCATTTTCCAAGGCTGATTCGTGTAGCTACCCTTGCCACAGT
TGTGACGGATGTATGGATGTTCTTGAACATTTCAGAAGGAGTGGTAGAAAAAAACACACA
TTCAGCCAACCACTTATATGAATTGAATGTATCAGAAGTGTACTGAAGGGACTGGAGATG
GTTTTCCTCAGATGAGGGGGCCCCAAAATTGATAGTGCACATCTGCACGCTTTCTGCGAG
GCCTCAGAACTTCCCAGGGCCCCTCCCTCAAATTGTCTCCATGGGAAACTTGACCCAGTG
GCAAGTTGCACTTTGGTGATCTTGGTGGTCTACACACCCGTTCTGTGGAGAGTCGATTTA
CATAAGCTGTGTATACACACACACACACACACACACACACCCCTACCCCACACTGACTGT
CTACCGACAAAGACCCTATTTCCTGGCAAACGGCCTCCTGAACCCTGACTTTTTGTGTAC
ATACTTGTAAACACGGATTTTTCTGGGTTTTGGTTTGCTTTTTCCTTTTTTCCCCCTGCC
CCTGTTCTAGCTTGTTCTTCTTGGTTTGCTTTCAACCTGCTTGATGGATGTCTGCAGAGT
GCTCTCTAAGAGTCCACCTCAGTGCCTCGTGTGCTCAGTGGTCATGGGAAAGGAGCGAAG
GAACCATCCTTGGTTCTCCCAGCTTGGTTGTGTAGCAATCCCTCAGCATTGTTTTTCTCA
GCTTCTTGGCAAAAATTAAAACAACAACAACAACAACAACAACAACAACAAACAGAAGGA
TAAACTGGCTTGCCTGTGGACCCTCCCCGGCTCTGGGGCCAGTCGAGAGCCACTGAGGGA
CCCAGCACTCAGAGACACAACACACATGTGTAGCTGCTTCTGGCTGAGTGTGTTTCCTGT
CACCAATGGCCTGTTTGGCTGGACGATGCCTCGGCTTGACCTTTTTTGAAAAGTGCTGGT
TAGTTCCCGCCCCTGGTAAACCTGGGGTAGGTGGGGGTTCTGTCTTAACTCGAGGGGCAC
CTGGGATCCAGGACGCTTCTAGGGGGCTCTGGCTGCCCGTGTTAATGAAGGACAGCGCTT
CCGCGAGCACCCTGGGAACTGGGTCTTGGGTAGCAAAGCCCTCCCAGAGAAAAGATTGGG
CACAACTAAGGCTTTCCTGAGCAGGAAGGGGGTGAAGACCAATCCCTTCCTTTGGTCCTT
TGGTACGCACCCCCTCAGAGCTGAGATGGAAGACATGGCTAGTTCTTTTCAGCCTTGTGG
AGCCTGTCAGTCGCCATCATACCTCGAGTGAGGCCCAGCTAGATAATGACTTGTCCAAGA
TGGCACACGTGGAAAGTTGATCTGCACCAGAACCCGGATGACTGTCACCTTGAAGCATCC
TGTTCTCCTTCTGTGCTGTCCCAGGAAGTGTCTGGCGGGCGTGGGCAGCACAGCTCTACA
CTGTACGATTCACTAGGGCATCCTGCGAGCCTCACTAGCCTTCTGGTTCATGCCTTTGAC
AAGCATTTTTGTGCCCCCTCTGCTTACTGTGACAGTCGATGATGAATCTTGCGTTGCCAT
TTTCTGCTGTGGGTAACTGCGTGCAGTGTCTTGCCTTGCTTTCTCTTCTTACTGTCCCAC
AGCTTGGTTTCATGTTACAAACAGAAAAGCTCGAGGCTCCCACCCCGCCACATCCCAACT
TCATTTCCCCCTCACTGTAGCCCATTTCCACCCCACCACAAAGTTGCCACAGGTTTTCTT
TGTATAGAATATTTATTTTGAAGCTCTATTTTAATAGTATTTATTTTAGAAAGTCTACTA
TTGTAAGAGTTCTTCTGTTTGTGAAGAAAAAAACAAGTTAAAAACTGAATGTACTGATTT
AGAAAATATATATAAATATATATTGTTAAATATA
cacgggactgccgtttctggtgtgtttgtgtgtttacttccctgacctcttcagccagca
aggcctcaagtttgagaataagcagccactgaaaggggaagagaagatagggcttcctgg
gctgggcaatcccttctcccagctctaggacgaccgtagaaccatcggaggaaagctgct