Gene SLIT3 Variant 1
DNA : 634.70 KbNT_023133
mRNA : 5015 bp NM_003062
CDS : 4572 bp NP_003053
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  460 bp
gtctgccgtgctcactgaatggagagagcgagcgccggccagctcacccggccgccccgt
gccccagccgcagccgccgcgctccccagcccagccccaagccggacctccccgggcgcc
acgccccattgcgctcgccccaggtccccaacccggcccgcgggccagcggggccagggg
GCGCTCCGCACCTGGGCACTCCCAGCGATGCGCAGCGGGGCAGCGCCGGCCCCGCCGATG
GAGCTGCTGTTGCTGCCGCCGCCGCCGCCCGGAGCGCCCCGCTCCGCCCGCGCCCCGTGC
GCCTGAGCACCGAGCTCGCCCCTCCTCCGCGCTAACTCCGCCGCCCGCTCCCCAGGCCGC
CCGCGCTCCCCGCGCGCCTCCTCGGGCTCCACGCGTCTTGCCCCGCAGAGGCAGCCTCCT
CCAGGAGCGGGGCCCTGCACACCATGGCCCCCGGGTGGGCAGGGGTCGGCGCCGCCGTGC
GCGCCCGCCTGGCGCTGGCCTTGGCGCTGGCGAGCGTCCTGAGTGGGCCTCCAGCCGTCG
CCTGCCCCACCAAGTGTACCTGCTCCGCTGCCAGCGTGGACTGCCACGGGCTGGGCCTCC
GCGCGGTTCCTCGGGGCATCCCCCGCAACGCTGAGCGCCT
gtgagtacccctgccccaccccacgcgggccacccacctgggtcccaccgagggggcccc
aggcgccagatccgtcctttcccctcggcctccctggatgcagtctctattctcatccct
tcctggatacgatccctcactctccgagctgggggtctgtaggcttggtcagatctggaa
EXON 2  72 bp
tgaatggtttattccatacaatatccttaaggttagccgggcacgctcaagggatatcgt
taatcatcagaattgccgccttctggacaagcaacatcccttcagtccaagccagtctgg
attaaatagaccgtaattgtaacccacaaaaatctgacctgaatttgctctccattgcag
TGACCTGGACAGAAATAATATCACCAGGATCACCAAGATGGACTTCGCTGGGCTCAAGAA
CCTCCGAGTCTT
gtaagtagttgatggctctcaagtgtgttttcatttttagctcttcagcctcacaaaaaa
atgttccactgcccctgacatcacactcccaagccctggacaacaggaattcaccattct
gcagcagaaagcccctcgttagcgtacccacatgcttacaggtatcacattctgtgtcta
EXON 3  72 bp
tggttaccgtgacaccaagctgggatatgagttatcttgtcccatcagactgatcccagt
tgaagggacactgacgatcatgggaagggctgagtgaccatgcctgcatggcatgaagcc
tagtatgagggtccctgagcccagctttgtccttagtcattgctgtctctgtggttgtag
GCATCTGGAAGACAACCAGGTCAGCGTCATCGAGAGAGGCGCCTTCCAGGACCTGAAGCA
GCTAGAGCGACT
gtaagtacagtacagcctcctttcttaaagtatttatttacatttagtgttttttgtttt
gttttgttttgtttttgtaaattggccttataaccttgttaaaaaaggtctccagtgttt
aaatagaatgtttgctattatacttaaggcacattagatgcatgttaaagaaacactgag
EXON 4  72 bp
tgactctaagccccgccaacagggaatataccttacatgtgttgagcagcccatactgaa
agacgtagagagtctcttaatgcctattgattgattgactgattgattaaagtggtatct
gaatacgtttgatctggtttaatgtccccttgacatccttccattctctttcctctttag
GCGCCTGAACAAGAATAAGCTGCAAGTCCTTCCAGAATTGCTTTTCCAGAGCACGCCGAA
GCTCACCAGACT
gtgagtagagttgccttgtgttctctaccttgtgccttgcctggcttgggtgatgtggag
gatgtggtttgtggagcgccgtgccgtgtggagcttggcagttaggccctgacatagaga
cttggagcagggctttgacatgacgtctacccccaacaaacacttccaggcctgacttct
EXON 5  72 bp
ccatcacttgaagaacaatgtgaatgcttgtagcagcctggggcccgagaccaaacagcc
gccatacactctgaccgcagaggcagcagcctgggtgggggggattgttatcatttaatg
agatgcagatcaagacagcctgggtctttaatgcagtgtgcctcttctcttcttgtttag
AGATTTGAGTGAAAACCAGATCCAGGGGATCCCGAGGAAGGCGTTCCGCGGCATCACCGA
TGTGAAGAACCT
gtaagtgatgttttccttgcttcactacgtatgtggctaacttgggctctctgaccagag
tgagggtgagggatgggacaagagggtggtccaggtgccttcagagatgaaattgagggc
tgtgcttgagtgatttctagggaacacacgttggatgccacaatactgtcacagaaacct
EXON 6  72 bp
tcagacagtcagagaggagagacggagcagcgtggcagacaggctggctctgcacgagct
cctggcggggaccagcagcgcctgcaagggggtggagggacaggcgctcgggtggcctgg
gccgccggcccctcacgctgcccccgctcagccttcatgctctcccctgcttttccacag
GCAACTGGACAACAACCACATCAGCTGCATTGAAGATGGAGCCTTCCGAGCGCTGCGCGA
TTTGGAGATCCT
gtgagttgattttgcgatcgctgccttgtgtgtgcgtgcatgtgtgtgtatgtgtgtgtg
tctgtgtggggaggagagagggggagagtgtgtgcaggagggtctgtgtgaatgcatttc
tggtctctgctgcagtgctattaaaattgggaaccaggggatccctccggctcaccttgg
EXON 7  72 bp
agggcatgctcttctcgtctggagacctgtccacttgtcttcagctgctccactggctgg
gccatgactgttgactcatggtcttgcggtcacaaccatccctcccccgacctactacaa
gcatcttggtgcctcccctgctgctgcctggctgaccatctcccttgtctatctccacag
TACCCTCAACAACAACAACATCAGTCGCATCCTGGTCACCAGCTTCAACCACATGCCGAA
GATCCGAACTCT
gtgagtaagaagtctgtgcatctctcccattttctccctacctcacgcccaaagtgcagc
actctacgctgcttgtcaaacctaccatgctatgactaggcagatggttccgacattcaa
attcctccttctgctattaaccaaggggtgccttggcgagtgagggtagatgtagagtca
EXON 8  164 bp
caatgaaagggttggggctcccatgtttttggtagtgcagagggaattgcttccctgggc
tcctagggattttcacactggagaaaggggcaacaggggttttggtcactctgtctggcc
agtgacagcctccacacttcacctgtgaccatgccttctctctgtcccgccctctcccag
GCGCCTCCACTCCAACCACCTGTACTGCGACTGCCACCTGGCCTGGCTCTCGGATTGGCT
GCGACAGCGACGGACAGTTGGCCAGTTCACACTCTGCATGGCTCCTGTGCATTTGAGGGG
CTTCAACGTGGCGGATGTGCAGAAGAAGGAGTACGTGTGCCCAG
gtgaggatgctttacctgctctcccctcctgtgctatgacccacccacccatgagctccc
acaacatcaccctgaccttgaacacataccctagcccagagcttggtgtggaaggaaccc
cataggtcgtcctcagtactcagtagtcacttaaagaactgtgacgtgcctcaaagggtt
EXON 9  142 bp
tttgctgaatatttagcctgtggcacctgtgtctcccaggtgaagggagatgtcagctgg
tgatcatttctcagatggctgtcaggtcatgctttgcccttaggatgctggttaaggaca
cagaagcccaggcagctcctgacactgacataagttgaccgttgtgtcttggctccacag
CCCCCCACTCGGAGCCCCCATCCTGCAATGCCAACTCCATCTCCTGCCCTTCGCCCTGCA
CGTGCAGCAATAACATCGTGGACTGTCGAGGAAAGGGCTTGATGGAGATTCCTGCCAACT
TGCCGGAGGGCATCGTCGAAAT
gtaagtgcacctgtctgacacccccaacaactgtcgccggagaattcagctccctgtccc
agcccatcacccactaggccatcagcgtgtggggctgctggagctgaccattaaaaacac
tcaggaatctctttgctgtccttccacactttcccagctatgatagcttggtggtcaaga
EXON 10  72 bp
atgtactaggacctgagttctctgactgctgcagtgttttgtctggtctgccacaaccag
accgtgcacctgtgacaaaaaagacctccctgtccttaaggccagagaacacagtagccc
tcagtgaccacttgttgacaggtggatggttaattcactcttctctgctctgtttcccag
ACGCCTAGAACAGAACTCCATCAAAGCCATCCCTGCAGGAGCCTTCACCCAGTACAAGAA
ACTGAAGCGAAT
gtgagtttcccctgtggagaaatgggcccaaatgttttcaatttccagggttgtttgcaa
tgtgtagtgggcaacctgtccaggtgacggaccatgtccattcctcctgggcagttctgt
ttcagacctggaacgctgtcctaagcttgggaggtaagatgtggaagtgttgcctgaaga
EXON 11  72 bp
tgaggtagttgaactgaaggctctttaagctccttctcttgcactatgagtaaatgaatt
gcttgattgattgattaatccttaccattttgaatgtctgaaatgcttgattcacactta
ggagtgaccgttatcgcacctttgagccatgttctcagactttaccgttaacgttttcag
AGACATCAGCAAGAATCAGATATCGGATATTGCTCCAGATGCCTTCCAGGGCCTGAAATC
ACTCACATCGCT
gtaagtggggcccgagttggggcctgaggtgaggggagggggggcgctggagggaagaga
gacgcaaccatatttctcaggaggtgtttatcaagactttatgttcccttacacacttgt
ggcaacctggtaaaagaaacaaatatttcttcaggggaaattgatcttggggaatatttc
EXON 12  72 bp
cagcccctggctgctcttggctgcctctgtctcgctgatgagaagggattaggcaggccg
tggaaggggttgtcctgagatctcatacccagaactggccgaggtgatggcttcctgcag
gactgggttctggtggcctcacatccacagtgattgctgtcttctccttctctctttcag
GGTCCTGTATGGGAACAAGATCACCGAGATTGTCAAGGGACTGTTTGATGGGCTGGTGTC
CCTACAGCTGCT
gtgagtaggaactttgtcactgttggtgtctttggtactgtcggaaggctcccacctgaa
aacgttgagccatgctctggagagttcttttgactttctgcagacaaaagagaaaaaaat
gtttgagctgtccacgcttcacctccgtttcctatttttatgaaaggagagtcagcgagc
EXON 13  144 bp
gtttggggtttcggtagacacaggaaggcaggtctctctctttttctgttctgcagcagg
agctcaaggctgcaaggatgagtgatgggagctttgcagcccatcccctgcaggtgcaac
ccttgccccgcaggtaattaccaggattagtgaatcaaccaggctctcttctgtttgcag
CCTCCTCAATGCCAACAAGATCAACTGCCTGCGGGTGAACACGTTTCAGGACCTGCAGAA
CCTCAACTTGCTCTCCCTGTATGACAACAAGCTGCAGACCATCAGCAAGGGGCTCTTCGC
CCCTCTGCAGTCCATCCAGACACT
gtgagtacactgcctcgggtgccagtgggtgcccaagcagcaggagaccccaaatgccca
tcatgaaaaacacccaaatgagggcagcacgagcacatccaggaggagttctagagcctg
cagggaagctagaataataaaaatcggaatagcttatcagtaccaagcacttacactgtg
EXON 14  164 bp
ggcctcagaccccctctttgagccctgtctgaaagtagcaccccctaaggcttcctgggg
cgatgaggcaggaggccagtccttgcagtggattgccagggcccagcgcgaggcagggtg
gtggtggtggagcaagacgccgtgggtcactcctgattaacggccccatccctctcgcag
CCACTTAGCCCAAAACCCATTTGTGTGCGACTGCCACTTGAAGTGGCTGGCCGACTACCT
CCAGGACAACCCCATCGAGACAAGCGGGGCCCGCTGCAGCAGCCCGCGCCGACTCGCCAA
CAAGCGCATCAGCCAGATCAAGAGCAAGAAGTTCCGCTGCTCAG
gtaatcaggttacggggctgggccccgctttctgactcagaatgcagcagccccagagag
gccaataatccaatctggaggacagcgagcactgtaatggctcctggggagcatctttgc
aaattaaattggggaaattcagttagccctgcagaaaaccagttaccttatggatttaaa
EXON 15  151 bp
ggggacagggaaggcaccagcaaggtggccatatagcaaaggcgatgccgtgtctgttac
ttgacccctaacagcccccaactcattcccccatctctgtctcccacccccactacccac
aacctggggctgtgcgtggaactcgggtgacgctgacgtcccctctttggcccctcccag
GCTCCGAGGATTACCGCAGCAGGTTCAGCAGCGAGTGCTTCATGGACCTCGTGTGCCCCG
AGAAGTGTCGCTGTGAGGGCACGATTGTGGACTGCTCCAACCAGAAGCTGGTCCGCATCC
CAAGCCACCTCCCTGAATATGTCACCGACCT
gtaagtccaacctcggcgtgaactccctactcctccccacacgccagtcacccggagcca
gcgtgggcagggtctcctggcggtgaccccttcctggctcagtcatgtggtgtttgttgg
ctgtctttcacatactggtctgaaggtagatacccaggcatctcctgtggacagcttgct
EXON 16  75 bp
tgcatatgcctccccaaactgctgggcccctctgttgatgggactgatgtcaaagcttcc
gatggctctgtggtccttcaccgagtgtgaggttcaggcagcaatgcagcaaagccatgg
ggggtggaaggaggggcctcgtccacagctaacctaccactcatcttgcttcctacacag
GCGACTGAATGACAATGAGGTATCTGTTCTGGAGGCCACTGGCATCTTCAAGAAGTTGCC
CAACCTGCGGAAAAT
gtaagtcaacttcaggaacttggcagcagcctctgttctctagccagagcctgtgttcta
gactagaggaaccaggggaccggcctctcccccagcctctgctccactccctcccagcct
tctcctcagccccgctgtggcctctgttaggaagcaagacatgtagacacagaccaaagt
EXON 17  144 bp
cctgggccagatgctgaagaccaaagttcagggagccccagactgagctccttccaccat
ccagtcctcagtctcaggggccccagagagtccccagcagctgcagggcaagtcatcccc
tcccggcatcaagaccatctgctccttttgattctcccctattctgtttcttccttctag
AAATCTGAGTAACAATAAGATCAAGGAGGTGCGAGAGGGAGCTTTCGATGGAGCAGCCAG
CGTGCAGGAGCTGATGCTGACAGGGAACCAGCTGGAGACCGTGCACGGGCGCGTGTTCCG
TGGCCTCAGTGGCCTCAAAACCTT
gtgagtgcctggggtggggcctgggccaagacccagagggagacgggagggcaggggaat
tagagacagactacgaaggcaagtgggacccaggcactgtcttggcctgctgaatccctc
tcttcctggagtcagagtcatcagacattctggagccttggatgggaaagaatttagcat
EXON 18  144 bp
acacagccccagtggggctccagtccctgctatcacaggacaaacctgatcaacatggct
ggactgagcttagaattggcaaaagcatctcacctatacacacacacacaccaccgtggc
accatttgggacagaaaagatcatgcctgtgctctctcatccccacccctctccctgtag
GATGCTGAGGAGTAACTTGATCGGCTGTGTGAGTAATGACACCTTTGCCGGCCTGAGTTC
GGTGAGACTGCTGTCCCTCTATGACAATCGGATCACCACCATCACCCCTGGGGCCTTCAC
CACGCTTGTCTCCCTGTCCACCAT
gtaagttctcctgggtccactgcccacggactctgggatcccactctgcagcgctctctc
ctcccagctccctgctacctctagccaggctcatctatctgtctgtccacttaaaaactc
gtcaggctttctgtatgtgccaggcaggcatcgtctaggtgttgaggctgcacacacccg
EXON 19  164 bp
atccatcagaggcgagggtctggaatgagaccctcacagagactgcatctggggaagagc
ctacgtttccttcctgagacctcctccttcctggctaggagagctgggctctgggcagca
gatcccagggccgctcccacagtagaaggatggaggctaagcacccttctctcttcctag
AAACCTCCTGTCCAACCCCTTCAACTGCAACTGCCACCTGGCCTGGCTCGGCAAGTGGTT
GAGGAAGAGGCGGATCGTCAGTGGGAACCCTAGGTGCCAGAAGCCATTTTTCCTCAAGGA
GATTCCCATCCAGGATGTGGCCATCCAGGACTTCACCTGTGATG
gtaagaaggctgtgggtcaaggtctgcggggaaggccctgggaaggcaaggaagatggcg
aagatgcacaatcagatactccctgagatccaattccactttgctttgggcatgcagctg
gagctctggagagctctgcagatctgctactagcccacatggctccttcatgcaaattaa
EXON 20  133 bp
aaaaggtaggcgacacccgccaaccacggatgagaccagcgggtaccctcttcctggttc
tagaacacagcggggacaggggacaacttgtctttgtggagaacacgcagccttgctcac
tggctccccctagtggggcttatctcccacaaccctcaccctctctggggctctccacag
GCAACGAGGAGAGTAGCTGCCAGCTGAGCCCGCGCTGCCCGGAGCAGTGCACCTGTATGG
AGACAGTGGTGCGATGCAGCAACAAGGGGCTCCGCGCCCTCCCCAGAGGCATGCCCAAGG
ATGTGACCGAGCT
gtaagtacccccagctgcctccaagcaccctgtcatctcaccaccagcagcatcctccat
actttaccccagaatctcaagcaaggcaacatggcgaaactgccggggggagaccctact
tgaatggatcccagcaagatggcagtggagccctcaccaagatggcagccatgggctttg
EXON 21  69 bp
attggataatcaaataaatattaaatgacaaatatagtaatgctttgaagttggggaggg
aggctctaagagtaaaagagggacctaatccagcctggaaagtcagggaggcttctctga
aaaggtgagaatttgtacagtgtctctttctcaggtgttgtctctccacacctctttcag
GTACCTGGAAGGAAACCACCTAACAGCCGTGCCCAGAGAGCTGTCCGCCCTCCGACACCT
GACGCTTAT
gtaaggagcccagtattgggtgggatgtttatttttccctgctggggtcgctcaggaaac
tgaagtggatggtaagagagaacagagctgcaggctgatgcaagtggtaattgaaagatg
cctgtctgcttaggaccagaagccagtctgcaaagggaaagtgggagatcttgcagaatg
EXON 22  72 bp
gagtagataaacaggccagcagcgggatggatagatgagtgagtgaattaatgaataggt
gggtggatgggtggatgggtagatgagtgggtggatggcaggtatgtgtgatacttggga
atggcctcctacagatgcaactaagacaaaagcatgacccctctgttttacttttcctag
TGACCTGAGCAACAACAGCATCAGCATGCTGACCAATTACACCTTCAGTAACATGTCTCA
CCTCTCCACTCT
gtgagtacactgagatgctgtgtttaccatgcccttgggcctagcagtagatggttactc
tttccctccctcccagcaggactagtttctctgccctaatgaccctcaggcctatggctg
ccctagcataagatacaccttaatcatcagaaggaagataaagtaggaagccctccactg
EXON 23  72 bp
aataaagccagtgcgcttcctggattggtgaagaggtttcttgtccctttaggggatgtt
ctgtcaatatatcaacattgaaaagataaaccatttgctttgtttcacaacgtgaacagt
gcacctatgcatggtagagaatagaaagacacaacagggcacatgcctccttttccacag
GATCCTGAGCTACAACCGGCTGAGGTGCATCCCCGTCCACGCCTTCAACGGGCTGCGGTC
CCTGCGAGTGCT
gtgagtaccccaatgtgctgattttgacttacacattgctgagtgacagcaggaagcaga
ctaagcactccccttccccactctctgcccaaagcccactccacccccaaacacaccttc
ctacccagcacccttatttgctcagtggagtagagagagctacctttgagagtctgccat
EXON 24  72 bp
ctgctgagctgggcatagaacattcatgcacccagagcaaagggggcagcagctactgct
aggagcagtggggctctgagcaaaactgaagggtggcagggccaggcactggaggccctg
agaatatgctaaattcaaattagtggatgctaaccttccgacctgtgccctctgcttcag
AACCCTCCATGGCAATGACATTTCCAGCGTTCCTGAAGGCTCCTTCAACGACCTCACATC
TCTTTCCCATCT
gtaagtagcagtgtttctccccaatgaacattcaaaacatgaaagcatgaaagtgtcagc
gacaatgtcatcactgtcagcattttggcagatgtcctttccttatgcatacagtatatt
atacaactatgtatccacactatgcatattgtcttgtttcccacctcagaagccttcaaa
EXON 25  164 bp
gattggaagtacactctggagatattaactttgccacagtggagacgactactccgctgg
ccccatattggatacctccagtctagccaaagtctgaaaatgcatttccagagagccaag
gatatgaaggctactggccaagctgggcagggggccctgacttcctgttctgcctcctag
GGCGCTGGGAACCAACCCACTCCACTGTGACTGCAGTCTTCGGTGGCTGTCGGAGTGGGT
GAAGGCGGGGTACAAGGAGCCTGGCATCGCCCGCTGCAGTAGCCCTGAGCCCATGGCTGA
CAGGCTCCTGCTCACCACCCCAACCCACCGCTTCCAGTGCAAAG
gtaggtgacgcccacaccccaccctcccctgcccctcttggggtctgctgtgttcccagc
aacctgtcagagcagggtatctcaacagatgtggcttcagaaaccttcaccctgtctctt
ccatgggtcccacaaagaggctcagatgctgacgctgatgtgaaccctcatctaatgggc
EXON 26  125 bp
tgaattaatgggactctagctggactggatgtgctggctgaggagagccagctgccatct
gggcatggagttgggaaggggctggcgctggctgagggagggcccagagcagaggggaag
ggaggtatggcagtgagcgcactcaggacctgccatcagtactctggttttgctgcccag
GGCCAGTGGACATCAACATTGTGGCCAAATGCAATGCCTGCCTCTCCAGCCCGTGCAAGA
ATAACGGGACATGCACCCAGGACCCTGTGGAGCTGTACCGCTGTGCCTGCCCCTACAGCT
ACAAG
gtatgctggaggccctgcccccccgtgttcatgcctcaggctcctccttcagccctggcc
ctagagaggggcaccatgccctgcgtaccctcccttctccaagggacagcctggatgagt
ccatcgcacaggtcaccactccaaagcagcatttgccagtaacactgttctctgaactag
EXON 27  98 bp
actaggggttagggctcccatgggtgggctccaagtcacacagcaggcctttcctagggg
ctccttgttgtcatctccccagcctcatcacagagaatgctggaacccctggagtcccct
gggccatggcagccccagaagtccccctaaccaggtgcttctccctcttttgctcctcag
GGCAAGGACTGCACTGTGCCCATCAACACCTGCATCCAGAACCCCTGTCAGCATGGAGGC
ACCTGCCACCTGAGTGACAGCCACAAGGATGGGTTCAG
gtaacagttcacccctggcctccctcactgtattagtttgctctcacactgctaataaag
acatacccaagactgggtaatttataaaggaaagaagtttaaaggactcacagttcagca
tggctgggaagcctcacaatcatggcagaaggcaaaggaaaagcaaacatcttaaatggc
EXON 28  140 bp
gttcctaagggtcttcctgctcaggaccccaaggcctcatgtgtccaaagtgctttctca
gacctccatctggaggaaaaactaattgtatttcccacccgtgtcttcctctctgccatc
ccaacccacctctctccctgacccctgactcccctgctctccacccctcacatcccaaag
CTGCTCCTGCCCTCTGGGCTTTGAGGGGCAGCGGTGTGAGATCAACCCAGATGACTGTGA
GGACAACGACTGCGAAAACAATGCCACCTGCGTGGACGGGATCAACAACTACGTGTGTAT
CTGTCCGCCTAACTACACAG
gtaaggatctcatgactgtatgtatggtggggtggaggggtgtcgctagaataccatttt
cttaacttcctccagggactctcttcctctctccctgaggacagagactaagaccccaag
actgtgatatgccaagaggggctccccaaaggcctgtttgcttctccgtgtcctccacca
EXON 29  94 bp
agaggtgcaggaggatacacaaggagtgagaacacaggactcctgacgtccatgcccacc
tgaccaggggctggatgagtctgatcttctggccaggatatcccccctagtactctgatc
ttctggccagggcatccctaccctgcctgaggcctgagctatctcccccatctgtgccag
GTGAGCTATGCGACGAGGTGATTGACCACTGTGTGCCTGAGCTGAACCTCTGTCAGCATG
AGGCCAAGTGCATCCCCCTGGACAAAGGATTCAG
gtaagacctggcttcgtgcccccagcacagagtccatgaaaactctgcctctaacagtct
aggttttaggcagtctctggtctctctgcatgctctctctctctctcatgtgcttctctg
catctctgattcagccatgatctaattatctcagtctgtttccctatgcgtgcctctgtc
EXON 30  138 bp
tggaacaaaggccatgggccaccagggaaacctgctgtggagccaggctttgcagatccc
aaaggaacttgggtagatagaagagatggggagaggccacctgctgaggggggctggaga
gtgactgcctgcaagctggctttgccttgaggaacggccttgcctctgcctatgttccag
CTGCGAGTGTGTCCCTGGCTACAGCGGGAAGCTCTGTGAGACAGACAATGATGACTGTGT
GGCCCACAAGTGCCGCCACGGGGCCCAGTGCGTGGACACAATCAATGGCTACACATGCAC
CTGCCCCCAGGGCTTCAG
gtaaggcaggagggcacctcaggaaggagacagcctgggccaggtggcaggggctggggc
tgactggctaaggtggccagaatggagactcaggcccaggtggctgtagccccggttctg
ggtgatgcctttattcccctgatacctttgcagtccttacatgtccccatgagggaaata
EXON 31  241 bp
gacttagagaaggaaaaggtcttgccccggttagtggcagggctggaactagcccctaga
actagtgtcatttcccatctcactctacctctctgctcgaggttctttggcctgagtaac
tgtgattgtctcctcttggccattctcctatctccctccccattctctcctgccttccag
TGGACCCTTCTGTGAACACCCCCCACCCATGGTCCTACTGCAGACCAGCCCATGCGACCA
GTACGAGTGCCAGAACGGGGCCCAGTGCATCGTGGTGCAGCAGGAGCCCACCTGCCGCTG
CCCACCAGGCTTCGCCGGCCCCAGATGCGAGAAGCTCATCACTGTCAACTTCGTGGGCAA
AGACTCCTACGTGGAACTGGCCTCCGCCAAGGTCCGACCCCAGGCCAACATCTCCCTGCA
G
gtgtgtcccgccctgccctgcccttggaaggacctcaacatgcccacaagctctgatagt
tcagaaaattgctggaatgccccatcttaacagtaaagcaccatcagggacaacactcag
cttgaggacatctggaccaactcatccagagagttctatagataactcctgaccagctct
EXON 32  131 bp
tgtaagtctaggccttaccttctggggatttactgactagatggaggaggaaagatggac
atgaatttagacgcagcacagattcagaagctgctgcctggaagagggctctgtgagatg
ggcagggaaggttcagtctcaggtaagcccttactaacacgccccggctgctttctccag
GTGGCCACTGACAAGGACAACGGCATCCTTCTCTACAAAGGAGACAATGACCCCCTGGCA
CTGGAGCTGTACCAGGGCCACGTGCGGCTGGTCTATGACAGCCTGAGTTCCCCTCCAACC
ACAGTGTACAG
gtaagggcctctctccctcctgacccactgtgtgttcctccgcatccttctgcctctggg
cctgcaactcagaagggggattcaggagaactcgggtgtcccttctccccgcccctacca
cgcacatgtgcgcacacacacacttcctcctcaccgagtggtgagtgggagggagaaagg
EXON 33  155 bp
actgggtaataagcatcttctgtactgtttttatttttgcaacttatgtaagtttaaagt
tatttccaaataaaaagtaaaacaaaatgtaagcaatgcaggtcaagtccacagcacagg
gcccagccatggaaggcccttagtgaactctccggctttctccccttctctactggccag
TGTGGAGACAGTGAATGATGGGCAGTTTCACAGTGTGGAGCTGGTGACGCTAAACCAGAC
CCTGAACCTAGTAGTGGACAAAGGAACTCCAAAGAGCCTGGGGAAGCTCCAGAAGCAGCC
AGCAGTGGGCATCAACAGCCCCCTCTACCTTGGAG
gtaatgccctctttccctaccacctctacctccctctggccctctgtgctccagtacaga
aacccaggccactgccaaagccaatcagggaaggcttcctggaggaagggacaacgaagc
tgatctctaaaaggtgaataagcactagccaggccatggaggaaagagaatgtgggacag
EXON 34  286 bp
aggaccaaggatgcacgtccctgtatggaggaggtccgaggttttggcccgttaacctcg
tttgaacagcagaggcccagagttctggccatgaatgtgtgaaaagtgctttttcgctct
gaggacagcagggtggcaggggagggtcttcaggccactgtcctggctcccctcccacag
GCATCCCCACCTCCACCGGCCTCTCTGCCTTGCGCCAGGGCACGGACCGGCCTCTAGGCG
GCTTCCACGGATGCATCCATGAGGTGCGCATCAACAACGAGCTGCAGGACTTCAAGGCCC
TCCCACCACAGTCCCTGGGGGTGTCACCAGGCTGCAAGTCCTGCACCGTGTGCAAGCACG
GCCTGTGCCGCTCCGTGGAGAAGGACAGCGTGGTGTGCGAGTGCCGCCCAGGCTGGACCG
GCCCACTCTGCGATCAGGAGGCCCGGGACCCCTGCCTCGGCCACAG
gtcagtgtcccaggagccctggctgtgtgctcgagctcccagaatggcctcagtccctac
cccacctgagaaataggcactactggaggctggaggagttgcagtcagaccgcagatagg
atctgtgtaagtgtaactgcttaagaggtcaagaggctgagcttacacatctgagcagcc
EXON 35  209 bp
gctggttggccaggggaaccaaggtggttaagaaaagagatgctcagcctaggaaacaga
gaaagctattggactgtactcagctccgggtcccctggtccctggctgggtggacagagg
gagtccccagcagcaccaactctgatccagttcccttctcatcctcctctctgcccctag
ATGCCACCATGGAAAATGTGTGGCAACTGGGACCTCATACATGTGCAAGTGTGCCGAGGG
CTATGGAGGGGACTTGTGTGACAACAAGAATGACTCTGCCAATGCCTGCTCAGCCTTCAA
GTGTCACCATGGGCAGTGCCACATCTCAGACCAAGGGGAGCCCTACTGCCTGTGCCAGCC
CGGCTTTAGCGGCGAGCACTGCCAACAAG
gtgggtctactgtgcctgtgggagggaggaagtgggggtcagagttggacttcacatcca
gatcacctcagttccagttctggctgtgccacttaaaggctgcatgaccttggttcagtc
actttctgagcctcaattccctcaacttgaaaacggaggcaatactataccttcctgtat
EXON 36  416 bp
ggaaaggcacctgtttgtaaaatagatgggtggatggaggggagggtaggcagatggatg
agtgaataaattcttacagtcttcagagcacaagtatttcaaagcagcctacctgggaac
tgctcatggtcctgctggccacctagaccaccaatgccctgacttctatgccctctgcag
AGAATCCGTGCCTGGGACAAGTAGTCCGAGAGGTGATCCGCCGCCAGAAAGGTTATGCAT
CATGTGCCACAGCCTCCAAGGTGCCCATCATGGAATGTCGTGGGGGCTGTGGGCCCCAGT
GCTGCCAGCCCACCCGCAGCAAGCGGCGGAAATACGTCTTCCAGTGCACGGACGGCTCCT
CGTTTGTAGAAGAGGTGGAGAGACACTTAGAGTGCGGCTGCCTCGCGTGTTCCTAAGCCC
CTGCCCGCCTGCCTGCCACCTCTCGGACTCCAGCTTGATGGAGTTGGGACAGCCATGTGG
GACCCCCTGGTGATTCAGCATGAAGGAAATGAAGCTGGAGAGGAAGGTAAAGAAGAAGAG
AATATTAAGTATATTGTAAAATAAACAAAAAATAGAACTTATTTTTATTATGGAAA
gtgactattttcatcttttattatataaatatattacaccatctgcgtatatgtaccata
tagtgagttatttttaccaagttttgtgttgtgtatttgttgtgtttttaaaaatagctg
tttaaaaatttaagaaaaaaatagactaataaaaatgctttaaaacaaaaggataagaat