Gene SLC22A5 Variant 1
DNA : 25.86 KbNT_034772
mRNA : 3234 bp NM_003060
CDS : 1674 bp NP_003051
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  614 bp
gagcccgggctacctcggtcgtccccagcaggcttggctggcagaggccgggcctcgcca
ggtccccaggacaggccccgcccgggcctcaggtgcactcccggcccgccccgcgccctc
gcgtcccgccccagctccgccttcgccggcgccgctctgcctgccagcggggcgcgcctt
GCGGCCCAGGCCCGCAACCTTCCCTGGTCGTGCGCCCTATGTAAGGCCAGCCGCGGCAGG
ACCAAGGCGGCGGTGTCAGCTCGCGAGCCTACCCTCCGCGGACGGTCTTGGGTCGCCTGC
TGCCTGGCTTGCCTGGTCGGCGGCGGGTGCCCCGCGCGCACGCGCAAAGCCCGCCGCGTT
CCCCGACCCCAGGCCGCGCTCTGTGGGCCTCTGAGGGCGGCATGCGGGACTACGACGAGG
TGACCGCCTTCCTGGGCGAGTGGGGGCCCTTCCAGCGCCTCATCTTCTTCCTGCTCAGCG
CCAGCATCATCCCCAATGGCTTCACCGGCCTGTCCTCCGTGTTCCTGATAGCGACCCCGG
AGCACCGCTGCCGGGTGCCGGACGCCGCGAACCTGAGCAGCGCCTGGCGCAACCACACTG
TCCCACTGCGGCTGCGGGACGGCCGCGAGGTGCCCCACAGCTGCCGCCGCTACCGGCTCG
CCACCATCGCCAACTTCTCGGCGCTTGGGCTGGAGCCGGGGCGCGACGTGGACCTGGGGC
AGCTGGAGCAGGAGAGCTGTCTGGATGGCTGGGAGTTCAGTCAGGACGTCTACCTGTCCA
CCATTGTGACCGAG
gtgggtgccggcccctgctggggctgagaccagggctcggaggacctgtcgcggtccttg
aacccgagctcctctctcccagatgcgcactggacgctgtcactccccctcccccaacgg
tcaacaccctagcgatggagaccctccagccaggtggcttgggaacgcttcacgaggtga
EXON 2  104 bp
ggatgggaaagaagcctgctctctgccttcctgcccaggtgagccatcacctgactaagt
gagttcacactcagagcgtgtggggatggcaggatgttctgacttcattttccaggatgc
ctttgctttaaaaccttttaaaaagaagtgaatgatacaccccctttgctcatcttgcag
TGGAACCTGGTGTGTGAGGACGACTGGAAGGCCCCACTCACAATCTCCTTGTTCTTCGTG
GGTGTGCTGTTGGGCTCCTTCATTTCAGGGCAGCTGTCAGACAG
gtaaggtgtctgtcttctggagcaccaggggacctcagcactgaggaagaagcgtgtgcc
tggcccttgatttcagttggtagtattctttcagcgcagggccctgtattttaaagaaga
ggaagctatgtctgtgatatagactccatgcctagtaagaagagccaacaaatctgactc
EXON 3  155 bp
gtggggagggggagaaatagcatgggcactgtgagaccgagactgtccctggcagccagt
attctggcaacactgttcacacccacttactggatggatcttgagaaagccccacttggt
ggagcccattcctgctgcccttttccagctggttatctgtcactctccttttcttcccag
GTTTGGCCGGAAGAATGTGCTGTTCGTGACCATGGGCATGCAGACAGGCTTCAGCTTCCT
GCAGATCTTCTCGAAGAATTTTGAGATGTTTGTCGTGCTGTTTGTCCTTGTAGGCATGGG
CCAGATCTCCAACTATGTGGCAGCATTTGTCCTGG
gtatgaccatcaggttggagttgagtacttgatcctgtatttcaccatcatcccatcacc
tacctttctggagacaactgtgatgtccctcaagggggacagggtttctaacaaaactag
ccagagcttcctggtgaaccttacttacaggcagggaaactgagccagacatgagaccag
EXON 4  172 bp
tgtacccccaggagacagtcagacaggaggggttcagaacgccatccgctccctagcgcc
atgaacttagagagagttctcgctgttttcttgtctgtgtattcacaaagataccataaa
aaattaataaggaaggaacccaaattaaactgctaactcgacctcccttgttttgaacag
GGACAGAAATTCTTGGCAAGTCAGTTCGTATAATATTCTCTACGTTAGGAGTGTGCATAT
TTTATGCATTTGGCTACATGGTGCTGCCACTGTTTGCTTACTTCATCCGAGACTGGCGGA
TGCTGCTGGTGGCGCTGACGATGCCGGGGGTGCTATGCGTGGCACTCTGGTG
gtgagtgtgaccttgtgccccatgtgcccactggcaggatgatttctgtctggccttcac
tagagggcagcaacaacccatgaatccctattttgtctcccagagacaggaagcatagat
tataaattatttcagaatgttttctccacactcaaaagagccaaaacaaaacagaatccc
EXON 5  127 bp
ctcatccaccccaggttattgctgcgtgtggatcagctctttgcttctggcttgtgatca
ccaaacattccacaagctctggttctgcaaccttattcccacctatggctgtgctctacc
tggtctgtgggtctgctgttggcagggaggcctcactgagattggaccttgtactgccag
GTTCATCCCTGAGTCCCCCCGATGGCTCATCTCTCAGGGACGATTTGAAGAGGCAGAGGT
GATCATCCGCAAGGCTGCCAAAGCCAATGGGATTGTTGTGCCTTCCACTATCTTTGACCC
GAGTGAG
gtaagcaccatgtgggtgtgggtgagagggacagactgaccgtgatttgagagcagcagc
acccagccctgaagtcctccctgctcacagcagcccagccctctctccgcccaagcccca
actgcccattccccccatccccccactccccacccccacacgggccctgttaacactcag
EXON 6  101 bp
ggcctagggaagttttcacagcctaaaacacagtcagtatacttactgttcttagaaacg
taacactccccgacgctgagatgcagacagctaagatgccagggattcaagtatgttatt
gtgtgctctgagtctctgaccacctcttcttcccatacacttatgatgttgttcctgcag
TTACAAGACCTAAGTTCCAAGAAGCAGCAGTCCCACAACATTCTGGATCTGCTTCGAACC
TGGAATATCCGGATGGTCACCATCATGTCCATAATGCTGTG
gtatgtaaaagagacctgcctgaggcttccagacaaagcttcttgaagtggccattgggc
ctcttgtttacagacatgcctcagacaaaattcaaagcctatgtcatcagagagtgaaaa
ggatatgtcttgtgttagatggaaaaaatgggcatgtcacaattcttaatgggatggaac
EXON 7  215 bp
gctggggaaaattatcttttgatctatgaagtaagacgcagggttacagttactgctgcc
ttactagtctctgcttaaagatggtttggaatttactgaaataattgcattgtaaaagtt
gtacaggttgggaaagatgtggatactgcttttccagctttcttctgcactctgtttcag
GATGACCATATCAGTGGGCTATTTTGGGCTTTCGCTTGATACTCCTAACTTGCATGGGGA
CATCTTTGTGAACTGCTTCCTTTCAGCGATGGTTGAAGTCCCAGCATATGTGTTGGCCTG
GCTGCTGCTGCAATATTTGCCCCGGCGCTATTCCATGGCCACTGCCCTCTTCCTGGGTGG
CAGTGTCCTTCTCTTCATGCAGCTGGTACCCCCAG
gtagggaccatgtgcatctatggtttggggtcttcactgagtctcttactgtctaccagg
ctgtctcaattaataaagagaataaaatcaagcccatcacagctcccttgcttatataca
ttcttggcctaaaaatcaatagaaagtgtcttctgagactagaacacttatggcctgggc
EXON 8  183 bp
agcctcctttcagcaatcaatttggagggaaatcttggctatagccccttcccccacaat
aggaagtgatagaaactgactccccaaaaaatttgggaagaaagtatgtttgttttgctc
tcaatagctgcatgccatgggttggtacctactcctaccctctttcctttgcttctccag
ACTTGTATTATTTGGCTACAGTCCTGGTGATGGTGGGCAAGTTTGGAGTCACGGCTGCCT
TTTCCATGGTCTACGTGTACACAGCCGAGCTGTATCCCACAGTGGTGAGAAACATGGGTG
TGGGAGTCAGCTCCACAGCATCCCGCCTGGGCAGCATCCTGTCTCCCTACTTCGTTTACC
TTG
gtaagtcccatgagccaagggcacactagagcaacgggatggaagtactaactggcttga
atgtgagctggaggttgcgtgttaacaggaaaacaagttcatacagtacatgggctccat
ccagtactggatctttggccgggaagggttcttgtcccagtgcactggccctcactttca
EXON 9  136 bp
agctctgggttctgaaacctgtctagatgccagattctaatctgactgctcagactgtga
gagatgtgagaccaagaaggaaagtgatccccttccagagtcctgggagcataaaggggt
agatgagagaccaagtctaactgcagccctgggcctgaggctccgtctgctttgccatag
GTGCCTACGACCGCTTCCTGCCCTACATTCTCATGGGAAGTCTGACCATCCTGACAGCCA
TCCTCACCTTGTTTCTCCCAGAGAGCTTCGGTACCCCACTCCCAGACACCATTGACCAGA
TGCTAAGAGTCAAAGG
gtaagaagacctcctctgtcagtgttgatgcactgggtctgggtctggccaggtctcagg
agcccctcacaatagagctactcgcaaactccctctcacagacaccatggactagtttag
ccattaaagggttgtaaatggcaaggtgcttacttatagcccatcctctctggtctgttc
EXON 10  1427 bp
tcactatacacatctccatggcagtagccgcactggataactcagaggctagaagaaacc
tttcagaatctgctgcaggattctcttcccagggaagatatcctcagttcttgtttgttt
ggagactgggaggcatctttttaaaatgtgttactgacatatttttgcttgtttttatag
AATGAAACACAGAAAAACTCCAAGTCACACAAGGATGTTAAAAGATGGTCAAGAAAGGCC
CACAATCCTTAAAAGCACAGCCTTCTAACATCGCTTCCAGTAAGGGAGAAACTGAAGAGG
AAAGACTGTCTTGCCAGAAATGGCCAGCTTGTGCAGACTCCGAGTCCTTCAGTGACAAAA
GGCCTTTGCTGTTTGTCCTCTTGACCTGTGTCTGACTTGCTCCTGGATGGGCACCCACAC
TCAGAGGCTACATATGGCCCTAGAGCACCACCTTCCTCTAGGGACACTGGGGCTACCTAC
AGACAACTTCATCTAAGTCCTAACTATTACAATGATGGACTCAGCACCTCCAAAGCAGTT
AATTTTTCACTAGAACCAGTGAGATCTGGAGGAATGTGAGAAGCATATGCTAAATGTACA
TTTTAATTTTAGACTACTTGAAAAGGCCCCTAATAAGGCTAGAGGTCTAAGTCCCCCACC
CCTTTCCCCACTCCCCTCTAGTGGTGAACTTTAGAGGAAAAGGAAGTAATTGCACAAGGA
GTTTGATTCTTACCTTTTCTCAGTTACAGAGGACATTAACTGGATCATTGCTTCCCCAGG
GCAGGAGAGCGCAGAGCTAGGGAAAGTGAAAGGTAATGAAGATGGAGCAGAATGAGCAGA
TGCAGATCACCAGCAAAGTGCACTGATGTGTGAGCTCTTAAGACCACTCAGCATGACGAC
TGAGTAGACTTGTTTACATCTGATCAAAGCACTGGGCTTGTCCAGGCTCATAATAAATGC
TCCATTGAATCTACTATTCTTGTTTTCCACTGCTGTGGAAACCTCCTTGCTACTATAGCG
TCTTATGTATGGTTTAAAGGAAATTTATCAGGTGAGAGAGATGAGCAACGTTGTCTTTTC
TCTCAAAGCTGTAATGTGGGTTTTGTTTTATTGTTTATTTGTTTGTTGTTGTATCCTTTT
CTCCTTGTTATTTGCCCTTCAGAATGCACTTGGGAAAGGCTGGTTCCTTAGCCTCCTGGT
TTGTGTCTTTTTTTTTTTTTTTTTAAAACAGAATCACTCTGGCAATTGTCTGCAGCTGCC
ACTGGTGCAAGGCCTTACCAGCCCTAGCCTCTAGCACTTCTCTAAGTGCCAAAAACAGTG
TCATTGTGTGTGTTCCTTTCTTGATACTTAGTCATGGGAGGATATTACAAAAAAGAAATT
TAAATTGTGTTCATAGTCTTTCAGAGTAGCTCACTTTAGTCCTGTAACTTTATTGGGTGA
TATTTTGTGTTCAGTGTAATTGTCTTCTCTTTGCTGATTATGTTACCATGGTACTCCTAA
AGCATATGCCTCACCTGGTTAAAAAAGAACAAACATGTTTTTGTGAAAGCTACTGAAGTG
CCTTGGGAAATGAGAAAGTTTTAATAAGTAAAATGATTTTTTAAATA
acagcaactgcctagaatctttatttctagaatttagtgagcctgtgccacactgtcatc
tgccttttctctgtatcagcttgggctaattctagcaatggttgggattaatctctaaga
ctaagatttgattcttgtgcactagaattcttcactttattaattgactatgggctgagc