Gene OTP Variant 1
DNA : 9.98 KbNT_006713
mRNA : 2677 bp NM_032109
CDS : 978 bp NP_115485
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  185 bp
gctgccgccgccgcctccttcaggcgggcgcaggcgagcgggcgggcggagtgggggact
ctccgggcgctgacatttgcaggctgccctcctgattggtcccctcgccgagctgctcac
gggttcattcaactgttaagcacctccccgtctctctaaaggacattataatgcaagaag
CCCCCTTTTTAACCACAAACCGAATTTTCTTTCATTTAGGTGATCTATATATATCTATAT
CGTATAGCTTATAGCTTATATCTATTTTAAATAACTTAAAGCCGCTAAAATTTGGGGGGG
AACAGCTTTCGCCCTGGAGCGGTGCGCGATGCTGTCTCATGCCGACCTCCTGGACGCCAG
GCTAG
gtgagtgcgcgcctctcgcccgggcagccaggagaagccggggcaggaaattgtcaattt
gttccttattttaccttaatgcgacctaaatggactaatttctttaaaagtaattgtgct
gcattaaagtttaatttgatttaacatcgcctttaaaaaaaaatctatggaatatgtaga
EXON 2  410 bp
tattccaacccggctgtccaaattctggggaacccagctgaataccctgggagtttcttc
cttaggacaagcgcgggtgcggagggggccgaggacgggttgaaggaaggctgcgcgggg
aagacagcccctcctggcatcgccaagaaagtagtgaccgcgatccccttgcctcctcag
GTATGAAAGATGCCGCCGAGCTTCTGGGCCACCGGGAGGCGGTGAAGTGTAGGCTGGGCG
TGGGGGGCTCCGACCCCGGGGGCCATCCGGGGGACCTGGCGCCCAACTCTGACCCAGTGG
AGGGAGCCACTCTGCTGCCCGGGGAGGACATCACCACAGTGGGCTCTACTCCGGCCTCGC
TGGCGGTGAGCGCCAAAGACCCGGACAAGCAGCCCGGGCCCCAGGGCGGCCCGAACCCCA
GCCAAGCCGGCCAGCAGCAGGGCCAACAGAAGCAGAAGCGCCACCGGACGCGCTTCACCC
CCGCACAGCTCAACGAGTTGGAGAGGAGCTTCGCCAAGACTCACTACCCCGACATCTTTA
TGCGTGAGGAGCTGGCACTGCGTATCGGGCTGACCGAGTCCCGAGTGCAG
gtacgaggggcttgggatctgggacagaaggcaaggacagggcgggaggatttgggcaaa
gggagcagggtcttcccttcccctgtcgagatcctgggctgctttcaggctgcctgtgcg
ttcctgtatcgagttatctccttctctacccggaaactggtccccatcgccatcccccaa
EXON 3  2082 bp
ggagttggtggggagccacagtctccggctgggtatgggggcttgtcgggcctacggcac
ttgttcctcccagggcagagcggctgtatccgaggcgggtttctggggctcaagccccaa
ctccccagccgccgggccggctaatagctccctgtctgtctcccgccccgcccgctccag
GTCTGGTTCCAGAACCGACGCGCCAAGTGGAAGAAGCGCAAAAAGACGACCAACGTGTTC
CGTGCGCCCGGCACACTGCTGCCCACGCCAGGCCTGCCTCAGTTCCCGTCGGCTGCCGCC
GCCGCTGCCGCCGCCATGGGCGACAGCCTGTGCTCTTTCCACGCCAACGACACCCGCTGG
GCGGCGGCCGCCATGCCTGGCGTGTCACAGCTGCCTCTGCCGCCGGCGCTGGGCAGGCAG
CAGGCCATGGCGCAGTCGCTGTCCCAGTGCAGCCTGGCGGCCGGTCCGCCGCCCAACTCC
ATGGGCCTGTCCAACAGCCTGGCGGGTTCCAACGGCGCGGGGCTGCAGTCGCACCTCTAC
CAGCCCGCCTTCCCCGGCATGGTGCCCGCCTCCCTCCCCGGCCCCAGCAACGTCTCCGGT
TCGCCCCAGCTCTGCAGCTCCCCGGACAGCAGCGACGTGTGGCGGGGCACCAGCATCGCC
TCCCTCCGCCGCAAGGCGCTAGAGCACACAGTCTCTATGAGCTTCACTTAATGCAGCCGC
GCCCCGGCCCGCTCCGCCCCCAGCACCGCCCCGGGGGCCGCCCCGAGGCCCTTCCGGCGC
GCACCCGGACCCCGGCGCCCTGCCCCGTCCCGCCCCGGCCTTCGCCCCGTCTCGTTTCGT
CCTCGCCTCTCTCCTCCACTCGCTCGGGCTCACCCCAAGCCCCAGCCCGCGAGGCCTCCC
CTCCGCCTGATTTCGATCGCCCGCGGTCCCCCGTCTCCCGGCCGCCCCTCTTCCCTTCCC
ACCCAGCTGCGCCCTCGGCTCGGTCTCCAGCGCCTCAGCCCACCCTTCCCGCCACCCTGG
CCTCCCTGCTTGCGCTGGCCGTGCTCGCGCCCTCCTCCTGGCCTTCTGACGGGCGGCGTT
CCCACCCACACCTTCGACGCGACGCCTACGACCCCCCTCGCCCGCCGCCTCCCCTCCGGT
CCCCTCTTTCCCCACACTTCGCGACCCTCCTCCCGCGCCCGGCAAAAAGTATCCTTCCCG
CCATTTTACGTACCAGGGAGTCGACTCAGGATCTGAAATCAGACACCAATGGACTGGTTT
GTGGGCAGAAACACACACACTCGCACTCTCGCTCACGCTCAGACGCTACACACGCGCGCG
CACAGACACGGTGCACCTAGGTCACACACGGACGTGTTCAAGGGACAGCACAATGTTAGG
GATTTTTGTCTTAAAGGAGGACAAGCATTGCTACCAACCGCCTCATCTGAGGGCCCAACT
GATATGATTTGATTTATCCTTGTACTCTCCAAGCTCCTGTCTTTCTTTCCTCTCCCACCA
CGCTACCCTTGCCCAGTCCACCCAGTCACATCCGTGCAGCCCTCTCTTGGCTTGCAAGAT
AACGCTTTTATTTTTATTTTATCTTATTTTCATTTTCTTAAGCACAACTGTGTGAGAGTG
TAGAAGGGAAGGCTTCTCAGGAGGAACGTGACAGTGGATTGGGTGGCTGGAGTAGACTAA
AGCAGTCATGTGACGAGGAAGAGGTGATCTGACCCATTTTGATAAGTCTTTATAAGGAAG
AATAAAATAAACGTGTAAGCAAAATTTTCTTTTGTAAAAGCAAAAGCCACATCTCTTTTC
TGGATCCTTCAGGACTGGGGTTTGTTTGCTTCCTTTTCTGTTTCTGTCTTCTCGCTGCTC
TGTGCCCTTGGTTGTTTTGTGGTGGTCCTGTCGTCCCTCGTGCCCCTCGGCCACCTGCTG
GCAGCCGATGGGGGCACTCGGACATCTACAACCCTGCAACTTTGTACAGAGAAACACAAT
CAGCTCTTTCTGCATGTGCTGGTCAAATCCAAACCCAGAGAACAGAAGCGCTTTCTAAGA
ATGAACAAATATGTGAAATAGGATGTTTTGTGTAGATAAAGCATTCTTGTTACATACTGG
TCAATTTGTGATATGTTTTAACTTAATGTCTGTGTTTATTTATGGAATTCGGTTTTCTTA
ATAAATGTTTGAGCTAATATAAAGCATATTATTTGACTTTTCCGGACAAGTTTATATCAA
GTTAAATGTAAATGGATAAAATAAAATCATTTTCAGTATGTG
atatagagaatgatgggttttggtgtgaccttgaacggcgggaggggtctcgtgggggga
ggggaggggccggtcttgggaatggttatattcgcgccagttggaacgcgtgggcccttc
gccctgcagtgggcttgggttcggtttctgggctgcaaggtgaggtctccgcgacggggc