Gene MEF2C Variant 1
DNA : 162.86 KbNT_006713
mRNA : 4072 bp NM_002397
CDS : 1422 bp NP_002388
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  253 bp
atccgaccggccgctgagagccactttctcctcctcctcctcctcctccttctcttcctc
ctccttcttcctcctcctcctcctcttccgagcggcctcggcgcgcgcgaatgcgcggcc
ccgcgccccccccctcgcgcgcgctcccctcgcgcgcgcgcacacacgcacacatcgtct
CCAGCTCTCTGCTCGCTCTGCTCGCAGTCACAGACACTTGAGCACACGCGTACACCCAGA
CATCTTCGGGCTGCTATTGGATTGACTTTGAAGGTTCTGTGTGGGTCGCCGTGGCTGCAT
GTTTGAATCAGGTGGAGAAGCACTTCAACGCTGGACGAAGTAAAGATTATTGTTGTTATT
TTTTTTTTCTCTCTCTCTCTCTCTTAAGAAAGGAAAATATCCCAAGGACTAATCTGATCG
GGTCTTCCTTCAT
gtaagtacccctgatatttctcgaggaaatagaaaacccgggtattgtctctaaaatctg
catcaatatattccacggcactgtgtctatctatccctgtgccttttttgaaggctgaag
ttgaggctcgttgtgcattctttttcgttagattccatgatttccttgtttgttgctaaa
EXON 2  196 bp
aaaactacttgatctgctcctgtctgtgatataccatatatttttaacaaaaaagttatt
tttattcattttattgctttagctccatatagtttatttccttgataaaattagaatatg
atagttcttatgaaactgacttgctgttagagtggtatttaatttttcttttttgttcag
CAGGAACGAATGCAGGAATTTGGGAACTGAGCTGTGCAAGTGCTGAAGAAGGAGATTTGT
TTGGAGGAAACAGGAAAGAGAAAGAAAAGGAAGGAAAAAATACATAATTTCAGGGACGAG
AGAGAGAAGAAAAACGGGGACTATGGGGAGAAAAAAGATTCAGATTACGAGGATTATGGA
TGAACGTAACAGACAG
gtgagtggagtaaactttttttgtatcattatttattaattatattttctccacatatgt
taagggtacagaaaatatcttgaatctgtaaatatctattaagagaagtttgggttaatt
aaatgtgaccagttaaagtgctgatagtctcttatatataaaggagaaaaaaatcacttt
EXON 3  204 bp
ttttcaaatgataagcagaaattaatattagatttatttgctttctttctgaatgtgtta
gtgcccagggctctgacaactacacaccattgttttgtgaaggaaaagaaaaaagaaaag
aaaaaaaccacacatgcatgaatattttttaaaaaatcttggctgctttcttttttctag
GTGACATTTACAAAGAGGAAATTTGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTG
TGTGACTGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCC
AGCACCGACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGC
CGGACAAACTCAGACATCGTGGAG
gtgagagagcatgcgtggtgagccccaagcctccgcaagcaggggagtttggacctcccc
ctgccacacacacatacacacatcatgttctttttcttaagatgttcatagtcccataga
tagacccaggattattatctatcgcaactcttactccaccttttctctccccttcaaaag
EXON 4  144 bp
ttaaactgctgatgagcactcgattgaaatgactcagctttcatctgtggtttctcttcc
ctaatagaataaagcatatgtaataacctgaaatactggacagcttgaacttctttaatg
cccctgaatgtctcttacagcctttgtctaggtttgaactttccaaattatgtatttcag
ACGTTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGATGCGGACGATTCC
GTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAAGATATTGATCTA
ATGATCAGCAGGCAAAGATTGTGT
gtaagtactcagaacacccttcattttttttactcttgatatttctctgaacctggcagg
cattgaacaagaaagaaaacaaaggctgtgaaagccccgatcccgactcctcttatgcac
tcaccccacgcactgaagaaaaatacaaaaaaattaatgaagaatttgataatatgatca
EXON 5  187 bp
agcacatttaagaaatcaatttatgatctgaacgtcttgagagctcttcttaatggtctt
ctagacacaaagtagtttggaatgtagaatttttcttggaaaaataagggctgtctgtct
tgaagagcttctgttattaattcttttcttttacctttgttttgttttctgttcctgcag
GCTGTTCCACCTCCCAACTTCGAGATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGT
TTGGTGTACAGCAACCCTGTCAGCTCACTGGGAAACCCCAACCTATTGCCACTGGCTCAC
CCTTCTCTGCAGAGGAATAGTATGTCTCCTGGTGTAACACATCGACCTCCAAGTGCAGGT
AACACAG
gtatgtcctcataaggatgtaatgctaacaaatagttggaaggaaccattttcggcaaag
ccaacactgctttatctacgagatgttttctggttttccacttactctccttcatggctt
accatccacccccgagctaggtctcctgcatgatagagcctaaattctttagtatgtttt
EXON 6  48 bp
tttttaacgtttgagcacagcatggcacaataaaacaaatgtcagccatctgacttgggt
tgtactttacaagtttatgactattgcaagaggacaaaatactgaggttgctgaaggtaa
agtgttttgttctgtgggcctttagcctttctcgttttgatcttcctctttaatccatag
GTGGTCTGATGGGTGGAGACCTCACGTCTGGTGCAGGCACCAGTGCAG
gtaagcccagactccatactgcagtatgtatcattgttctgagttcttctactaggtgat
ttgcaggacaaagtcttttgaacaaataaagttaagagatctgtgagaggcatggaaaaa
tgacaccaagaatttttaaagcacttttctgaagcaggagtggttaaatagtaacttaga
EXON 7  173 bp
agaggactattgaatacttaattgggttacttgtcccatggaggtcaaatcagtcatcct
atggttttgcaatgtacgtcttaccattaagcttttgtttttattctcatgttgtgtatt
cttcggaaacgtatttgacctagatttcttcctaaatgctttattgttttttgttaacag
GGAACGGGTATGGCAATCCCCGAAACTCACCAGGTCTGCTGGTCTCACCTGGTAACTTGA
ACAAGAATATGCAAGCAAAATCTCCTCCCCCAATGAATTTAGGAATGAATAACCGTAAAC
CAGATCTCCGAGTTCTTATTCCACCAGGCAGCAAGAATACGATGCCATCAGTG
gtaatacaaaactacattttaaataaatattgataatgttttgtatatgttttgctgttt
ttatatttgtctaacttgatgaattacttaacattctcccagaaaattaacataacagtg
ccattgacagagccttgcttgtatttagctattatttctggtaactggtttgcatttccc
EXON 8  24 bp
acagctcattaagggaaacaaagaatgtctttgtaaggagttatctttggagtctgggtt
ttaaaactgtttaaactgttgtgtctatcggaagatgcttttccttttgttgaaaagatt
ttgcccaattataaatatttacggacactaattaataaaactccttccgcatgctctcag
TCTGAGGATGTCGACCTGCTTTTG
gtaagtggtgagagcgcttccctcaaatggcatgtgcaaagctacttttaggtagaggtg
gtagctttgataaaattggaagatattggaagttaccacagtatgtcaacattgattatg
tttaaataccattaatttctggcatcactcacaggtgaaaagaatgtcaggttttttttt
EXON 9  130 bp
tggtctcttgaaggattgtaaatgatagggttggcagagttcatagagacacatgttaaa
tgattaatttcatgagatttgtaccaagttatctctttatgtggaaaactaatactgaaa
tctaatatttttaacttttaaaaaaattcatcagtaatgtctttttatttattttaaaag
AATCAAAGGATAAATAACTCCCAGTCGGCTCAGTCATTGGCTACCCCAGTGGTTTCCGTA
GCAACTCCTACTTTACCAGGACAAGGAATGGGAGGATATCCATCAGCCATTTCAACAACA
TATGGTACCG
gtgagtagctttgtcatgtgcaattagtacactaaatactttttattgaaaatcaagatg
aaaaagttatcttttactctattaggaagctttatttagggcctgcgccgtccacagcac
tgcagcattacccattcttcactaagacaaagtgaatatccacatttttctttcttaact
EXON 10  136 bp
tattccttttaaattagaattatcgctgatgctttatctcccctcccctcaaaattaaaa
atatctataataacgataatcctaatagaatattttggaaattgaaaatgtttattctat
ttaccatttgataatttctaaatttaatattttcccttgttgttttattctttaatctag
AGTACTCTCTGAGTAGTGCAGACCTGTCATCTCTGTCTGGGTTTAACACCGCCAGCGCTC
TTCACCTTGGTTCAGTAACTGGCTGGCAACAGCAACACCTACATAACATGCCACCATCTG
CCCTCAGTCAGTTGGG
gtaagcaatattattttttataatataattttagaatgtattttgaaaaacaaatgacag
tctctaaatatgtgcttcaatatcccattaacgggtataaaactctactttattgaaatc
caagtgtaattttcagatcaatacttttcaagtagcttaaatcttatatacctgtttttt
EXON 11  2577 bp
aaaggcatcctaaatcgccctgagaaggcgatgcccttatgtgcttccaagcacgttttc
ttcactctgggcatgctctggtgtctatgcgagtctttaagctgatgtttgatttaattg
tgagttcctggggcctccaggcctccttcatctgtaactgggtttcctttcctcctacag
AGCTTGCACTAGCACTCATTTATCTCAGAGTTCAAATCTCTCCCTGCCTTCTACTCAAAG
CCTCAACATCAAGTCAGAACCTGTTTCTCCTCCTAGAGACCGTACCACCACCCCTTCGAG
ATACCCACAACACACGCGCCACGAGGCGGGGAGATCTCCTGTTGACAGCTTGAGCAGCTG
TAGCAGTTCGTACGACGGGAGCGACCGAGAGGATCACCGGAACGAATTCCACTCCCCCAT
TGGACTCACCAGACCTTCGCCGGACGAAAGGGAAAGTCCCTCAGTCAAGCGCATGCGACT
TTCTGAAGGATGGGCAACATGATCAGATTATTACTTACTAGTTTTTTTTTTTTTCTTGCA
GTGTGTGTGTGTGCTATACCTTAATGGGGAAGGGGGGTCGATATGCATTATATGTGCCGT
GTGTGGAAAAAAAAAAAGTCAGGTACTCTGTTTTGTAAAAGTACTTTTAAATTGCCTCAG
TGATACAGTATAAAGATAAACAGAAATGCTGAGATAAGCTTAGCACTTGAGTTGTACAAC
AGAACACTTGTACAAAATAGATTTTAAGGCTAACTTCTTTTCACTGTTGTGCTCCTTTGC
AAAATGTATGTTACAATAGATAGTGTCATGTTGCAGGTTCAACGTTATTTACATGTAAAT
AGACAAAAGGAAACATTTGCCAAAAGCGGCAGATCTTTACTGAAAGAGAGAGCAGCTGTT
ATGCAACATATAGAAAAATGTATAGATGCTTGGACAGACCCGGTAATGGGTGGCCATTGG
TAAATGTTAGGAACACACCAGGTCACCTGACATCCCAAGAATGCTCACAAACCTGCAGGC
ATATCATTGGCGTATGGCACTCATTAAAAAGGATCAGAGACCATTAAAAGAGGACCATAC
CTATTAAAAAAAAATGTGGAGTTGGAGGGCTAACATATTTAATTAAATAAATAAATAAAT
CTGGGTCTGCATCTCTTATTAAATAAAAATATAAAAATATGTACATTACATTTTGCTTAT
TTTCATATAAAAGGTAAGACAGAGTTTGCAAAGCATTTGTGGCTTTTTGTAGTTTACTTA
AGCCAAAATGTGTTTTTTTCCCCTTGATAGCTTCGCTAATATTTTAAACAGTCCTGTAAA
AAACCAAAAAGGACTTTTTGTATAGAAAGCACTACCCTAAGCCATGAAGAACTCCATGCT
TTGCTAACCAAGATAACTGTTTTCTCTTTGTAGAAGTTTTGTTTTTGAAATGTGTATTTC
TAATTATATAAAATATTAAGAATCTTTTAAAAAAATCTGTGAAATTAACATGCTTGTGTA
TAGCTTTCTAATATATATAATATTATGGTAATAGCAGAAGTTTTGTTATCTTAATAGCGG
GAGGGGGGTATATTTGTGCAGTTGCACATTTGAGTAACTATTTTCTTTCTGTTTTCTTTT
ACTCTGCTTACATTTTATAAGTTTAAGGTCAGCTGTCAAAAGGATAACCTGTGGGGTTAG
AACATATCACATTGCAACACCCTAAATTGTTTTTAATACATTAGCAATCTATTGGGTCAA
CTGACATCCATTGTATATACTAGTTTCTTTCATGCTATTTTTATTTTGTTTTTTGCATTT
TTATCAAATGCAGGGCCCCTTTCTGATCTCACCATTTCACCATGCATCTTGGAATTCAGT
AAGTGCATATCCTAACTTGCCCATATTCTAAATCATCTGGTTGGTTTTCAGCCTAGAATT
TGATACGCTTTTTAGAAATATGCCCAGAATAGAAAAGCTATGTTGGGGCACATGTCCTGC
AAATATGGCCCTAGAAACAAGTGATATGGAATTTACTTGGTGAATAAGTTATAAATTCCC
ACAGAAGAAAAATGTGAAAGACTGGGTGCTAGACAAGAAGGAAGCAGGTAAAGGGATAGT
TGCTTTGTCATCCGTTTTTAATTATTTTAACTGACCCTTGACAATCTTGTCAGCAATATA
GGACTGTTGAACAATCCCGGTGTGTCAGGACCCCCAAATGTCACTTCTGCATAAAGCATG
TATGTCATCTATTTTTTCTTCAATAAAGAGATTTAATAGCCATTTCAAGAAATCCCATAA
AGAACCTCTCTATGTCCCTTTTTTTAATTTAAAAAAAATGACTCTTGTCTAATATTCGTC
TATAAGGGATTAATTTTCAGACCCTTTAATAAGTGAGTGCCATAAGAAAGTCAATATATA
TTGTTTAAAAGATATTTCAGTCTAGGAAAGATTTTCCTTCTCTTGGAATGTGAAGATCTG
TCGATTCATCTCCAATCATATGCATTGACATACACAGCAAAGAAGATATAGGCAGTAATA
TCAACACTGCTATATCATGTGTAGGACATTTCTTATCCATTTTTTCTCTTTTACTTGCAT
AGTTGCTATGTGTTTCTCATTGTAAAAGGCTGCCGCTGGGTGGCAGAAGCCAAGAGACCT
TATTAACTAGGCTATATTTTTCTTAACTTGATCTGAAATCCACAATTAGACCACAATGCA
CCTTTGGTTGTATCCATAAAGGATGCTAGCCTGCCTTGTACTAATGTTTTATATATT
aaaaaaaaaaaatctatcaaccatttcatatatatcccactactcaaggtatccatggaa
catgaaagaataacatttatgcagaggaaaaacaaaaacatccctgaaaatatacacact
catacacacacacgcacaggggaataaaataagaaaatcattttcctcaccatagacttg