Gene MAT2B Variant 1
DNA : 13.70 KbNT_023133
mRNA : 2032 bp NM_013283
CDS : 1005 bp NP_037415
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  131 bp
ttttgtgtgtcgctttaagcatcggcgcgtgggctgggggcagaccgcgcgtacccgccc
tctttctggggcgtcggcggagcgtggccaatcaacgggcgcggctatggcagcggaagc
cggaagcggcgagcggggtcgttctgggcctaggggaggcgggccgagggcgtctgagct
GAGGCCCGCGTCGATCCTGGGTTGGAGGAGGTGGCGGCCGCTGAGGCTGCGGCGTGAAGA
CGGCGGGCATGGTGGGGCGGGAGAAAGAGCTCTCTATACACTTTGTTCCCGGGAGCTGTC
GGCTGGTGGAG
gtgagggagtcggcctgggcgtctccggtgggagcgggggcgccgagggggacgagccac
cggggctcgggcggctttgcaggcgtattccgcccgggtcagagcctccggccgggagtg
gtctcaccgccaccctcccagccccggatccgaggggggcgccaccgagtttgtttatct
EXON 2  195 bp
gaattacaggcatgagcctgatgcccgaccctaacttaactttagaattggcttgcagat
atgggacatgagtcaaaatacgtagaattaagacatttagggaacaacgatggtgcctaa
tatatttgagagaactgttttcaaagttagtaactctttctatccgccttcaccttttag
GAGGAAGTTAACATCCCTAATAGGAGGGTTCTGGTTACTGGTGCCACTGGGCTTCTTGGC
AGAGCTGTACACAAAGAATTTCAGCAGAATAATTGGCATGCAGTTGGCTGTGGTTTCAGA
AGAGCAAGACCAAAATTTGAACAGGTTAATCTGTTGGATTCTAATGCAGTTCATCACATC
ATTCATGATTTTCAG
gtatgatttaggttattttaagatatacatgaacaatattaagagttgtctggatgatac
agaaactatccttgctctcaaggaaattactatgtttgaaagctctaaagttgtattatg
cagtagcatttttttcatttagcatgacatggtatatgtaaaccttaaagttaaattttg
EXON 3  115 bp
tttgaaccttgcggggaaaagaagcagcatgacaaaactacattagaaattacaatgatt
tattcttagttgaaagaatgttgacttactgcacatttttctctgaattaactttaagaa
ggctgtaatacctctttcattttattttgagttaaaaatacgtcaatgcttaacttctag
CCCCATGTTATAGTACATTGTGCAGCAGAGAGAAGACCAGATGTTGTAGAAAATCAGCCA
GATGCTGCCTCTCAACTTAATGTGGATGCTTCTGGGAATTTAGCAAAGGAAGCAG
gtaatgatgactttataaaattttcataaaatattaagtgattgctgagtttttagaaat
taaggttttgtagatggttatttgtttttatatatcatgaaaaaccattctaaattccat
gaaagagtaatgtcatgtaaacatttaatagatttgtcttctttttttgtagctgctgtt
EXON 4  153 bp
ggaagcaggtaatgatgactttataaaattttcataaaatattaagtgattgctgagttt
ttagaaattaaggttttgtagatggttatttgtttttatatatcatgaaaaaccattcta
aattccatgaaagagtaatgtcatgtaaacatttaatagatttgtcttctttttttgtag
CTGCTGTTGGAGCATTTCTCATCTACATTAGCTCAGATTATGTATTTGATGGAACAAATC
CACCTTACAGAGAGGAAGACATACCAGCTCCCCTAAATTTGTATGGCAAAACAAAATTAG
ATGGAGAAAAGGCTGTCCTGGAGAACAATCTAG
gtaagacctaatctatttagcccctgattgtttttgaagactttaaaaatcatttataca
tacacatatatatgttttaaatttaaaaagtcaatgaatatgaatcattagagaaaaatt
agaatatagttaataaagaaaataaaaaattctaagagataactactttgtgaatccttc
EXON 5  194 bp
ctgtgcctggccttgaatatttttacattgcgttgtcacaagtgagctgtgtcattttgg
tatattttaattaaaaggcaaggtttctactttgatattatttaaatccacacccttgta
tcttacatcaaaatttaagaatcagtcagctttaaattatttgcttttattcttctctag
GAGCTGCTGTTTTGAGGATTCCTATTCTGTATGGGGAAGTTGAAAAGCTCGAAGAAAGTG
CTGTGACTGTTATGTTTGATAAAGTGCAGTTCAGCAACAAGTCAGCAAACATGGATCACT
GGCAGCAGAGGTTCCCCACACATGTCAAAGATGTGGCCACTGTGTGCCGGCAGCTAGCAG
AGAAGAGAATGCTG
gtaagaaggattcctgagtcctgtcttagcgaaggtccgctttgtcttttccatgcttga
actttcacagctgtacttggagtgttactgagtgaaagccaaaagtgcttttttaaaact
aggagaccaaacaaaagtagtttacatatacactgtattcatgaagaataaaaatattat
EXON 6  114 bp
aagtgttttgctaagagtattagtaggaatttgattttagatatcttgtggagacctttc
cagaaaaagagggttgccttttagttcctggaccttattttaagtaagctttttggtcaa
acctattctactcagctcaaaaagttgaaactattgaatttattgtgtcatcgttcttag
GATCCATCAATTAAGGGAACCTTTCACTGGTCTGGCAATGAACAGATGACTAAGTATGAA
ATGGCATGTGCAATTGCAGATGCCTTCAACCTCCCCAGCAGTCACTTAAGACCT
gtaagtacatggctgtaaaaacctttagatccattgctatggtatatattattgctgtgt
tgggtaacttcatttctcagtactaatcaaagtgaactttgcttgtatgctggctgttca
tagtgctacttttctctaaattatcatctgtagagaagatcatgagtattgaagtttgta
EXON 7  1130 bp
gaggctgacgcaggaggatcccttgagcccaggaatttgagactagcctgggcaatggag
ggagatctcatctctgtttaaaaatatatacatatttaaaaaaaggtcagggggaacaaa
gccctcaaaatatagcctttcacttacttttgatttttttgtgtttatctttctttaaag
ATTACTGACAGCCCTGTCCTAGGAGCACAACGTCCGAGAAATGCTCAGCTTGACTGCTCC
AAATTGGAGACCTTGGGCATTGGCCAACGAACACCATTTCGAATTGGAATCAAAGAATCA
CTTTGGCCTTTCCTCATTGACAAGAGATGGAGACAAACGGTCTTTCATTAGTTTATTTGT
GTTGGGTTCTTTTTTTTTTTTAAATGAAAAGTATAGTATGTGGCACTTTTTAAAGAACAA
AGGAAATAGTTTTGTATGAGTACTTTAATTGTGACTCTTAGGATCTTTCAGGTAAATGAT
GCTCTTGCACTAGTGAAATTGTCTAAAGAAACTAAAGGGCAGTCATGCCCTGTTTGCAGT
AATTTTTCTTTTTATCATTTTGTTTGTCCTGGCTAAACTTGGAGTTTGAGTATAGTAAAT
TATGATCCTTAAATATTTGAGAGTCAGGATGAAGCAGATCTGCTGTAGACTTTTCAGATG
AAATTGTTCATTCTCGTAACCTCCATATTTTCAGGATTTTTGAAGCTGTTGACCTTTTCA
TGTTGATTATTTTAAATTGTGTGAAATAGTATAAAAATCATTGGTGTTCATTATTTGCTT
TGCCTGAGCTCAGATCAAAATGTTTGAAGAAAGGAACTTTATTTTTGCAAGTTACGTACA
GTTTTTATGCTTGAGATATTTCAACATGTTATGTATATTGGAACTTCTACAGCTTGATGC
CTCCTGCTTTTATAGCAGTTTATGGGGAGCACTTGAAAGAGCGTGTGTACATGTATTTTT
TTTCTAGGCAAACATTGAATGCAAACGTGTATTTTTTTAATATAAATATATAACTGTCCT
TTTCATCCCATGTTGCCGCTAAGTGATATTTCATATGTGTGGTTATACTCATAATAATGG
GCCTTGTAAGTCTTTTCACCATTCATGAATAATAATAAATATGTACTGCTGGCATGTAAT
GCTTAGTTTTCTTGTATTTACTTCTTTTTTTAAATGTAAGGACCAAACTTCTAAACTAAT
TGTTCTTTTGTTGCTTTAATTTTTAAAAATTACATTCTTCTGATGTAACATGTGATACAT
ACAAAAGAATATAGTTTAATATGTATTGAAATAAAACACAATAAAATTAA
cacttgatccagaatgttaacttaccaccccatcctagaatgttacagttactgtatcta
tttgtgggaacggatttgtttttaactaaaaattaatagctatataatcttgttacatta
tacagttgacccttgaacggtgtgggtttggggtatcaaccttgcacagtctaaaatcca