Gene LHFPL2 Variant 1
DNA : 25.06 KbNT_006713
mRNA : 4428 bp NM_005779
CDS : 687 bp NP_005770
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  505 bp
ggtgtcgctgcgcggcgggaaggcggggcggggcctggcggcgctgctaaccgccctccc
tctcccctaggtgaggccgcaggcggtgctctgggtccgggagcgctgtccccagcatga
acgcggccggcggcgggagtgaatgactgcagctgcgacttccttcccgggccgcccgag
CCTCCTTCCCCACCGACTTTCTTGTTTTGATTAACTCCGTGGACTCCTGACTCTTTCTTC
GCCCGGAACATCAATATGTGTCATGTCATTGTCACCTGTCGCTCGATGCTCTGGACCTTG
CTGAGTATTGTGGTGGCTTTTGCCGAGCTCATTGCCTTCATGAGTGCAGACTGGCTGATC
GGGAAAGCGAGGAGCCGCGGCGGCGTGGAGCCGGCGGGCCCGGGCGGGGGCTCCCCGGAG
CCCTACCACCCCACCCTGGGCATCTACGCCCGCTGCATCCGGAACCCAGGGGTGCAGCAC
TTCCAGCGGGACACGCTGTGCGGGCCCTACGCCGAGAGCTTCGGCGAGATCGCCAGCGGC
TTCTGGCAGGCCACAGCTATTTTCCTGGCTGTGGGAATCTTTATTCTCTGCATGGTGGCC
TTGGTGTCCGTCTTCACCATGTGTGTACAGAGCATCATGAAGAAAAGCATCTTCAATGTC
TGTGGGCTGTTGCAAGGAATTGCAG
gtaagaaggcaggaccccgggcacggtgggatggagggatggagagctgccggtgcagcg
cactctggtactgggcattcgcttcctgctagttttggagaagaccactttctgtctatt
caggtttcctttgccccttccgttctaggcgacgtttgtgtgctgctcgcatgggtctct
EXON 2  3923 bp
tctaataatgtgatacttcttgatcaggtcagattagtttgcatgaaacagtcccaacac
tttctattgcagaatagatgcccttgcccaaagcaagcaaatcaagtaacaattacaaca
gatctggacagttgtagcaccatggggattttctaatctgttttctcttttgttctgcag
GTCTATTCCTTATCCTCGGTTTGATACTCTACCCTGCTGGCTGGGGTTGCCAGAAGGCCA
TAGACTACTGTGGACATTATGCATCTGCCTACAAACCTGGAGACTGCTCCTTGGGCTGGG
CCTTTTATACCGCCATTGGGGGCACAGTCCTCACTTTCATCTGTGCTGTCTTCTCTGCAC
AAGCAGAAATTGCAACCTCTAGTGACAAAGTACAGGAAGAAATTGAAGAGGGGAAAAATC
TGATCTGCCTCCTTTAGTTTGGAAGAGACAATGCCATTTTCTCCCTTGAGTAATCTTGTG
AAACAGTCCACAGTTTCATCATTTGAGTCAAGTGGAGAACTAACCTTTACCTACCAAAGC
CACGTTCCACGGCCCGAGGCTTAAACAGGACCAATGAGAGGCCACATCCAGCTACGCAAA
GTTACTGGACATGCGGTCTGCAGTGCACATTATAAGGAATGGAACATGAAAATAGTATAT
AATCCTAGACCTGGAGTTGCCAAGTTCTGTCAGACTCCATCTCCCCCAGGTTCAATGAAG
GATAATAATCTAAATCATTAGGGCAGCAGTTTCTCTGGTAACGGAAGAGACCGTCCGCCA
GATCTGCAGGCTGTTTCTGCTCCAACACTGCTTGCTTGTGAGCATCTCTGCCTCAGAATG
GGGTTTTGGGTTGGAGTTCTTGTTTTCCTCTGTTCTTTCAAGTTGTCTCCAACGAACAGA
AAACTATAAACTTACTGGGGACAGGATGTGTGCTAAAGGGCACAGCAAGACACTGTCTTT
TGCTTAGCTGACCAAAGGGGTCAGCAGGGATGGCGTGGAGTCATGCTGTGGAACTTATTC
TAGGCTGAATCCTAGGGTAAGGTGGATCAACTGAACTGTCACTCCAGAGATTTTAGAAAT
TTGAGTAAAGAAACAATAAGGACCTATACAATCATATGAGAACAAAAATATGAAATCTTG
CTAGTGAAGACGTATTTTTTCTTCTTCCCAGCAGCCAGGCTAGCACCAGTTCTGGCCCAG
TCTCCTCTTCTTCTGGAGATCACATGTTTTTCTTCTAAGGTTAGGATTGTGCTTTGACTG
CGAAAGGAAACCTCACTGTTTCCTCCTTCCAGGGACTGAGGTCTCCAAGCTAGCTGTGGC
TTATGCAGATGTTCACTGGGAGGACCTGCCAGAATCTCGGCACTTGGGGGGAGACCTTTA
CTCCCAGTTTGGTGACCATGCTGTAGTCAGCTCTATTTCCAATCCCGACAGTAGCAGAAT
GGCATTCTACAACAAAAAGAAGCTAGTTATGGGAGTTAAGTTTTTGTAGTTACTGGTGTT
GATCCTGAAAGCAGACTGAGATAACATTAAATTGCTGCAACTGAAGAACTGCAGCCAAGA
CCTTAATTCCAGGAAAGCACAGAGGACAAAGTTAATTCAAAAAGAGGCGCTAGATCAAGG
TCACAGCACTGCCTACACCTGTTTACAAAAAGAATCAAATACCACTATGAATAAGGATTC
AGGGGTTTTTAATCTACTTTCCATAAATTACCAATATCACTGATTCAGGAAGATAGTATC
TCAGAATGACCAGAGCAGCACAGAAACAAGCTACTCTGACATTATGGGAGCTTCAAAATT
GTATCATGATACAGAAACACTCCTTAGCACTTTAAGAAAGTGAGATGGAACTGCCAGATT
TCTGGAAGGAGAAAAAGTGTAGGTATTTGGGTTCATTAATCTGCTCACTTGAGGACTTTG
TTTTGAAAAAGTACCTTCTGTGGACAAGGTATTGTGCTACCAGCTATACAACCCTGACTT
CAGAGTTTGCAACCTTGCCCTGAGTGAATCATGTTAAAGCTGTCTGAGTCTAAAGCACCG
TATCTTGGTGCAGAACAGATAATTATACAGAGATGGAATGGGACAACCGCAGTTTTACTA
CATTCTGGTGTTTGGCCTATATGAGAAACCATCTTCTCACAGATTAAGGGCTAAGGGCAA
AAGGGGTGGGAGGTGTGGAACTAGCCTTAATGAGTTTCCCATTCCTGAACCAAAATTCAA
AGTGAGTGAGATGTAAATCCTGTGATTTTGGTGAAGAAAAAAACGGGTATCTTCATAGCA
GCCTAGGAAACCTTAACCATATCTCTAACACCACACAGAAAGAGGCTGGAGGAGCCACTG
GACAAAGCTTCTGTCTCTGTGTGTACATTTATAATGTTCTAACCAAGTCTCAAACCTTGA
TGAAAAACACAAAATTTTTCCATAAACTTATCAGAAGACTCACTTTTCTTTCTTTCTTGG
ATAGAGAAACCATTTTCTGACACTAGGTTTACAATCTCAGTGTCCTTACAAGTTAAGTCC
TAAGCTCACAGGATCCTCCGAGCATGTCCATCACCTGCTCTTTGGCTAAGGTGGCAGTGT
ACCTCTAGATCAACCTGGGAACAGTCACAAGGGAGTGTGACTTCTTGGCCATAATAAACT
CACTCGATAGTGTTTATGTTATTAATCTGAATGCAACAGAAGACAAAAGCACAGGCATGC
ACACACACAGAACCCCAAACCACTAAAAACTACCTAAACACTGACTTAGTAAATAGTAAA
AAGGTAATGTTGGGACTTTTAAACCTTGAATCCATTAGCCAGGCTTGGGATGAAAGGACC
ATCTAAAATCATGCTAGTCTAAACCATGCTCTTCCACACAGCTGTTTAAAAACCACTGGG
TATGAGGAATATGCTAGAAAGAAATGTTAAAAATAGATTGTTGGCTCACACTTATTTTTC
TAATAAATAGGACCATTATTACTACCAGGAAAGTCTTATTTATTTTGCCTGAAATTGGCT
TAAAGAAAGTCTCATGACGGGATGGGATGGGCTGCGCTTCTCAATGAACTCTGAGGCAGA
AATATTTGCCTTGGATTCTGTGGATTCTTTAAACCTGTGTGCTAATAATTCAAACAATGT
TGCATTAATTGTATAAGGGTTTTTGTATAGTTTTCAAACATCTGTGGTGTAATGATCTTT
GTTAAACATATATTCTGTAAAGTGCCATAGTCTTTTTTTATGTGTAGCATATTTAAAAAT
ATATATGTATATTATACATACACAAGTTTGTGTGAAAGATGTGCAATAACAAAGGTGTAT
GTATGTTTTGTTGTTTTGTTTTGGAAACTGGACAGGAGTCAAAACAGGGATGTTTGTTTC
TGTTTTGGCAAGGAGAGTTCCACATTTTTGCCTTCATGGCTTATTCAGTAACCCATAATT
TTAATGCTACACAAATCTTATGTGAAGAAAAGACTGGTATGAAATCATTTTTTCCTGGGT
CTAAAATAATCGCTAGTGTTATGTCAAAGTTAAGCCCGCACGCCAGGCCCAGTTAATGCT
AGTCTTTCATGTGAAATGTGAAGCTGCCATGTTGCCTTTTCTCTTAGTAGGATAACTAGT
AGCTGGTACATAATCACTGAGGAGCTATTTCTTAACATGCTTTTATAGACCATGCTAATG
CTAGACCAGTATTTAAGGGCTAATCTCACACCTCCTTAGCTGTAAGAGTCTGGCTTAGAA
CAGACCTCTCTGTGCAATAACTTGTGGCCACTGGAAATCCCTGGGCCGGCATTTGTATTG
GGGTTGCAATGACTCCCAAGGGCCAAAAGAGTTAAAGGCACGACTGGGATTTCTTCTGAG
ACTGTGGTGAAACTCCTTCCAAGGCTGAGGGGGTCAGTAGGTGCTCTGGAGGGACTCGGC
ACCACTTGATATTCAACAGCCACTTGAGCCAAATATAAAATTGTATTTACAGCTGATGGA
CTCAATTTGAGCCTTCAAACTTGTAGTTATCCTATTATATTGTAAACTAATACATTGTCT
AGCATTGATTTGGTTCCTGTGCATATGTATTTTCACTATGTGCTCCCCTCCCCAGATCTT
AATTAAACCAGATTTTGCAATTC
attcttattctttcaagtctgagtatactggcttcaatatgatgtgtataatctgatcaa
gaaaatacctatcaatcagtcaacatttattttaaacactaacttacatgtaatattgat
gaatggaaaaaagatattcaggtattttaaactatcccattcactagtaacatatatgtc