Gene KIF3A Variant 1
DNA : 37.85 KbNT_034772
mRNA : 2104 bp NM_007054
CDS : 2104 bp NP_008985
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  275 bp
cttttaataaacttttcagctatatgtaagatctttaattgcatttaacaaatacctgtg
aagtgtttaatgtgtgcaaggcactgagttggaaaagtagccttttaaagtttataaatt
taatctgatgagggtaaaaattaatgttcttttcattatttgtaaatattatctccaaca
GATCAATAAATCAGAGAAGCCAGAAAGCTGCGATAATGTGAAGGTTGTTGTTAGGTGCCG
GCCCCTCAATGAGAGAGAGAAATCAATGTGCTACAAACAGGCTGTCAGTGTGGATGAGAT
GAGGGGAACTATCACTGTACATAAGACTGATTCTTCCAATGAACCTCCAAAGACATTTAC
TTTTGATACTGTTTTTGGACCAGAGAGTAAACAACTTGATGTTTATAACTTAACTGCAAG
ACCTATTATTGATTCTGTACTTGAAGGCTACAATG
gtaagtgaatctttactttttaaaaaactcccttattgagacataattactgtgccataa
attcacatattgcagctgtgcagtttgatgagtgtagtaaatatatacagttgtgaaacc
atcatcacaatccagctttagaacacccttgtcatcctcaaaatttcctttatgcccatt
EXON 2  147 bp
ttgtgcttgtggtacagagtacgcattgtaattgttgataataaaggtgaaacttgtgct
agaataaattttgaatccaggggagaaattacatcacagtgtcaaaggaattaattttaa
gagctattgttctgtagcattagactttaagaagtaactgattctcttcatcattttcag
GGACTATTTTTGCATATGGACAAACCGGAACAGGCAAAACTTTTACCATGGAAGGTGTTC
GAGCTATTCCTGAACTTAGAGGAATAATTCCCAATTCATTTGCTCACATATTTGGTCATA
TTGCAAAAGCGGAGGGTGATACAAGGT
aaaagggaattcttttattttctgatattgagaagtacaaacactggaaaggcacatagg
tataaattttataaacatattttaaaaccgttcttatgaatatttcactctttgactttt
taaaaatgatgttttatagatttttggttcgagtgtcttatttggaaatatataatgaag
EXON 3  83 bp
tatttggtcatattgcaaaagcggagggtgatacaaggtaaaagggaattcttttatttt
ctgatattgagaagtacaaacactggaaaggcacataggtataaattttataaacatatt
ttaaaaccgttcttatgaatatttcactctttgactttttaaaaatgatgttttatagat
TTTTGGTTCGAGTGTCTTATTTGGAAATATATAATGAAGAAGTTCGTGACCTTTTGGGCA
AGGATCAGACACAAAGGTTAGAG
gtaaggataattgaaattggtggagtactttttccaaagcaatagaatatttgctaaatt
aaggtcccccttctttttttaaacaaaagttgctttttatattttaaataatctcgtaca
tatataatgtcgtacatctgcagacatatctggggataaattactgaagcaggattgctg
EXON 4  106 bp
ttttatgtgtaattcttcatttgtatgttcttcctatagacatctccatgcgtgtaggaa
cagtgtctatcttatcagtatattccctctgtctagtagagtgtccaacacataggagat
actcaataaataattgtggaagagttattgatatagtataaagtcttaatttttttttag
GTTAAAGAAAGACCTGATGTGGGAGTTTATATCAAAGATTTATCAGCTTATGTGGTAAAT
AATGCTGATGATATGGATAGAATTATGACGCTAGGCCACAAAAATC
gtaagtatagtgtgtaattgtgattaagcatctgtgtgttgagtaggctggtttagaagc
aaatttggtatggcactttaccctgtagagactggattttttaggtttcttgaaaaccat
tccactttgattatttaccatgtagagagcatagatgaatgaaagataccacaaatcatt
EXON 5  140 bp
acaaagtataagagaaatttcatgtagtggctaagtacacacccatgcctttatggttta
gccatgctctctggcttttgattgtgataaaattaagtgttttaaactgttcaggatgtt
taattatttttaaaggcactctctgttacacttttaaaggatttcgtttatttattaaag
GTTCTGTTGGTGCAACTAATATGAACGAACATAGTTCCCGTTCCCATGCCATCTTTACAA
TTACTATAGAATGCAGTGAAAAAGGCATTGATGGTAACATGCATGTCAGGATGGGGAAGC
TCCATCTTGTAGATCTTGCT
gtaagtaacaggacactgcttaaggaataactctttcttgtgatccatttattttataaa
tgaatgaaaattaaagtgaaaaggtatgatttacatatgatttttaaggtgttacttgtg
tatgtttattatttattatggaacatttcaaatgtatatgaaagtagatagaatagtata
EXON 6  198 bp
tcatggctaatcttgtttcatgtactctcccccacttcttcctttcctatattattttga
agtgaattcaggcatcatatcaggttttttactgttacattactttttaataaaaccttg
ggaagaatattctatttttaaaaaaattttagctttactttcatctctgtttattgctag
GGTTCAGAAAGACAGGCAAAAACTGGAGCTACTGGACAGCGCCTAAAGGAAGCTACAAAA
ATCAATCTTTCACTTTCCACCCTTGGTAATGTAATTTCTGCCTTGGTTGATGGAAAAAGC
ACTCATGTGCCTTATCGTAACTCTAAACTGACTCGTCTTCTTCAGGATTCCTTAGGAGGA
AATTCAAAAACCATGATG
gtaagacttaattggtgatatagttaacatcaggcaaatttaagattgtaatttatgcca
ataattgatacgtatcacattttttaaacttgattattttactttttttgacttgtggtt
gtcctttttgtggtacactcgtgtattagcccataatagtgtcctttggaaactcatgtg
EXON 7  175 bp
tacactcgtgtattagcccataatagtgtcctttggaaactcatgtggttgacactctca
ttttcgagaaggccaagggtgcatatgtgctttaaatgtttttgatgtatttgtaatggt
agtattaattttaactctgtcaagtgtaaaatgatttgtttcatatttctaattcaatag
TGTGCAAATATTGGGCCAGCAGATTACAATTATGATGAAACTATCAGTACATTACGGTAT
GCCAATCGTGCTAAGAATATTAAAAATAAAGCTAGAATTAATGAAGATCCAAAGGATGCT
TTGCTGCGTCAGTTCCAGAAAGAAATAGAAGAACTGAAAAAGAAGCTTGAAGAAG
gtagcttttcctcaaaatattaatctttatgttggctaaaaatacattgttgaaccacta
actgttctaacaaaagccctctattaaaccttttttgagcctctaacattggtagttaaa
tgaatatttctagaaagtgacttggtacttacatactttcgcattttcatattaagctta
EXON 8  97 bp
gatatctcatctgtgtctgagattggcatatctgttatactttctaggagcatttaaata
gtatttaaatttgttgtttgcagtaacaaaaatctgaggaagaaagctgatataggtatt
tcctaaatagctaatgacttcgtacaggataaaaaacattgtattaaatttctgtccaag
GAGAAGAAATATCAGGCTCTGATATCAGTGGGTCAGAGGAAGATGATGATGAAGAGGGTG
AGGTTGGAGAAGATGGAGAGAAAAGGAAAAAAAGAAG
gggtaagttctgtttagtaatctgatttgtagaaattaggtggtttcacaaggtggtaga
gtgcatgacttttattttgccgttatctgtttaatatattagataacaattagaacagaa
gatgtatgccatttacctggttaactttgcattttttctcctgtattgatccgtttatag
EXON 9  169 bp
atgagttataaagttctaggagcataataaatggaaatgcatgatattattggtttgatt
tccttaaaatattgataattggttttgtattattgaggagtgtaggcatttctatattga
aggaggtaatttatataagtctgaaacattgattcattttagtgattgttgcaattaaat
GATTCAAATAGGAAAAAAGAAAGTCTCCCCAGACAAGATGATTGAAATGCAAGCAAAAAT
TGATGAGGAGAGAAAAGCACTTGAAACAAAGCTCGACATGGAAGAAGAAGAAAGAAACAA
GGCTAGAGCTGAATTAGAGAAACGGGAAAAAGATCTTCTTAAAGCCCAG
tgagtattattgaattgagatgaattcatgatttaaatttctgttttttcctaggatata
taaaataggaaaattgaatagtaattaaaagcttggatttttgtctccagtgtagctatt
ttggatagaagggtccattgtatatagtgtatttctaaaaactagatctattttggttat
EXON 10  180 bp
agaatgagttataaattaagttagaaatcgatactacacagtggtgtaatttggcagaga
tgttacataattatatttctattttgaaattgtatatccaaattttaaattttgggaaat
gatattagtagaataatagatcatcagtgaatatagagtattctcattctaatcaacaga
CAAGAGCATCAGTCTTTGCTGGAAAAATTATCTGCCCTGGAAAAGAAGGTAATTGTTGGT
GGGGTTGACTTGTTGGCCAAAGCTGAGGAACAAGAGAAACTTCTTGAAGAATCTAACATG
GAACTGGAAGAAAGGAGGAAAAGAGCAGAGCAACTTCGCAGAGAACTTGAGGAAAAAGAG

gtaatgtgactttctgtttttagtttggtattttgccagagagatttaacttttctagtg
gaaagctaaatatctataatcgtattgaaattttaaagcatatttatggattgctttgaa
gatcagatttgctaaacatttatgtcatttgttaaagaattagatatttgattttacaaa
EXON 11  111 bp
cagagagatttaacttttctagtggaaagctaaatatctataatcgtattgaaattttaa
agcatatttatggattgctttgaagatcagatttgctaaacatttatgtcatttgttaaa
gaattagatatttgattttacaaagaaatttattctgaagtttactaatttttgtcatag
CAAGAACGCTTGGATATTGAAGAAAAATATACCAGTTTGCAAGAGGAAGCACAGGGAAAG
ACCAAGAAGTTAAAGAAAGTTTGGACTATGCTGATGGCTGCAAAGTCAGAG
gttggttctcttagaaattacctactaatgcagttctggattttttaaaagggagttctt
tgattaagaatttataaataatcataatgtgagcttataatttaaaagaaataaaatatt
tctttatgtgcaatttttaattttatctattagtctaaattgtttcttttcaaccttaac
EXON 12  126 bp
cttttcaaccttaacaaatagtgtagaatagatgctgatagtgtcacgctgtttatcatt
tttataaaagaactaggtaagctctcacaaggtttcttagacaagcatcctatgtgagat
ggtgctgttttgtagttaaagtcttgtttgttcataatatttttatggattttctggtag
ATGGCTGATCTCCAACAAGAACATCAGAGGGAAATTGAAGGCCTACTGGAGAACATTCGG
CAACTTAGCCGGGAGCTTCGACTTCAGATGCTTATTATTGATAACTTTATACCTCGGGAT
TATCAG
gtaaaaaggaagttctctgaccgagatagtcgcttgactgggattaaggaacaaagattt
ctaatttaactgatgataaatacttaatacttcagttattgaatgtacaattttttgaac
aaatgccatcacatttcactttagttgttaacttttaatacataatctctgtttgagtat
EXON 13  54 bp
ttatttcatctgcatgcattcctaagaaatatgtattttagaatttataaaaaggttata
tcagtatataatgttttgagacttttattactcaatgttattaagattttagttttatga
cttcaatattttagatgttattaaatattaaaaataggctatctttcacccttttaaaag
GAAATGATTGAAAACTATGTCCATTGGAATGAAGACATAGGAGAATGGCAGCTA
gtgagtattaccttcattctttcacgtaataattaaagagtacttcctatggtctagaaa
ttgtgctggctacagtggggaggaacatggtccagtagatgaatcagatgagaatccagt
agggcagataaaatatttttctaattccatgtaattaattgtaacatacagatcatggtc
EXON 14  69 bp
ggtggaaatggtcagagttaggggctatgtgggactaagtgacctctggggccctttctg
ctctagcattcaaatcatgttttactagtgtaatgttaggatttctcagttatttgccta
actcacagtattgattactaattaagacatttctctgtctctcccttttctttttttgag
AAATGTGTTGCTTATACAGGAAATAACATGAGGAAGCAAACCCCAGTACCTGATAAAAAG
GAGAAAGAT
gtaagagtacttaaaaaaaaacaaaacaaaacacaaaactactgttgtttctttatagga
atatgagtcattaaattgtattatcaacttgatatctgttaatcagctctgctgaaaaat
gggctgatacttttgggaataaaggctctaggatggggtgatgaggaggacagttctgct
EXON 15  126 bp
accaacctttattaagtacattttagatactgggattagaagatgatgtcattagacatt
tctttggttttagcttctgtgggtttgatcaaggagtttattcagtattttaaatcttcc
cccaaatctggctttaactctttgccttaagagtgctttgtgtttgtttcttttacttag
CCCTTTGAGGTGGACCTTTCTCACGTGTATCTTGCCTATACTGAGGAGAGTCTGCGTCAG
TCTTTGATGAAACTAGAAAGACCACGAACTTCAAAGGGGAAAGCAAGGCCAAAGACAGGG
AGAAGG
taaggactgtccttgaatctggtaaaacgaaggcattgaggtattctaattagatacatg
tacaggaagttaaaatttatttagttaaaacatgatacatattttggctgatttattaaa
aatcaaattcctggctgggcacagtggctcacgcctgtaatcccagcattttgggaggcc
EXON 16  48 bp
agcttcccgtagcctgaaaaggcgagcattaattgaacacttaccatggtcaaacgtgtc
aaattttggcttgtttccagactatacaggccaccccatagtttctatataatgttaaat
gtttgcatttcagtcttttaggaaagcattcatgattgctttttttcttctccaaacaga
AAGCGTTCTGCAAAGCCTGAAACTGTAATTGACTCTTTACTGCAGTAA
atgttacagacttaaagtcacaataaaaattagtgatattctcatgcctggacaaaatct
ttaattaaaacagtgaagacttctctataatttcaattaatggaagttgtagatcaatga
ataagactggaaataataatttgcttaagaacttttagtctacatatattaatataacat