Gene IL3 Variant 1
DNA : 2.55 KbNT_034772
mRNA : 924 bp NM_000588
CDS : 459 bp NP_000579
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  215 bp
tgatcttgagtactagaaagtcatggatgaataattacgtctgtggttttctatggaggt
tccatgtcagataaagatccttccgacgcctgccccacaccaccacctccccccgccttg
cccggggttgtgggcaccttgctgctgcacatataaggcgggaggctgttgccaactctt
CAGAGCCCCACGAAGGACCAGAACAAGACAGAGTGCCTCCTGCCGATCCAAACATGAGCC
GCCTGCCCGTCCTGCTCCTGCTCCAACTCCTGGTCCGCCCCGGACTCCAAGCTCCCATGA
CCCAGACAACGCCCTTGAAGACAAGCTGGGTTAACTGCTCTAACATGATCGATGAAATTA
TAACACACTTAAAGCAGCCACCTTTGCCTTTGCTG
gtgagtagcttggataagactggcctgcagcagtgaggggtggtggctgcctaaggccaa
aaggcctcatgggcctttctctcccttcacccccacaggacttcaacaacctcaatgggg
aagaccaagacattctgatggtaagagctcagcccgtggatcccgatccacttcctgcct
EXON 2  42 bp
cttgaagacaagctgggttaactgctctaacatgatcgatgaaattataacacacttaaa
gcagccacctttgcctttgctggtgagtagcttggataagactggcctgcagcagtgagg
ggtggtggctgcctaaggccaaaaggcctcatgggcctttctctcccttcacccccacag
GACTTCAACAACCTCAATGGGGAAGACCAAGACATTCTGATG
gtaagagctcagcccgtggatcccgatccacttcctgcctgggtgacttcagccatgtca
ttccatcttacctagccttgctttcttcatctgtaaaatagggttaatagcacctatctc
agtgggattgttatgacaatcaaatggcacaatgtgcatgttctggcccagcatctggca
EXON 3  90 bp
cactcacttctaggcctgtgcccttgggcagggacccacctgaggcaagaacgggactag
gagggaacccgaggatgtccccaacagtgggcttgggaaactgtgggggtgacttccacc
tgcttgtgggagggatactctgtaacctttcccccttaagtgtattctctgccccgttag
GAAAATAACCTTCGAAGGCCAAACCTGGAGGCATTCAACAGGGCTGTCAAGAGTTTACAG
AACGCATCAGCAATTGAGAGCATTCTTAAA
gtatgtgaagctgttgagggtttgggatccctgtgttggccctgccctgcctctggggag
gagagcagggcccactccctttccaagggaatctctgaccatctgctttggtctctttcc
acagaatctcctgccatgtctgcccctggccacggccgcacccacggtaagctgtccccc
EXON 4  42 bp
tcaacagggctgtcaagagtttacagaacgcatcagcaattgagagcattcttaaagtat
gtgaagctgttgagggtttgggatccctgtgttggccctgccctgcctctggggaggaga
gcagggcccactccctttccaagggaatctctgaccatctgctttggtctctttccacag
AATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACG
gtaagctgtcccccaagatgcccgtcatggcttgctcctcagctggtcatcaccattaca
gcctggactcacctaatgccaccttcttggtttctttatagcgacatccaatccatatca
aggacggtgactggaatgaattccggaggaaactgacgttctatctgaaaacccttgaga
EXON 5  535 bp
ggaatctctgaccatctgctttggtctctttccacagaatctcctgccatgtctgcccct
ggccacggccgcacccacggtaagctgtcccccaagatgcccgtcatggcttgctcctca
gctggtcatcaccattacagcctggactcacctaatgccaccttcttggtttctttatag
CGACATCCAATCCATATCAAGGACGGTGACTGGAATGAATTCCGGAGGAAACTGACGTTC
TATCTGAAAACCCTTGAGAATGCGCAGGCTCAACAGACGACTTTGAGCCTCGCGATCTTT
TGAGTCCAACGTCCAGCTCGTTCTCTGGGCCTTCTCACCACAGAGCCTCGGGACATCAAA
AACAGCAGAACTTCTGAAACCTCTGGGTCATCTCTCACACATTCCAGGACCAGAAGCATT
TCACCTTTTCCTGCGGCATCAGATGAATTGTTAATTATCTAATTTCTGAAATGTGCAGCT
CCCATTTGGCCTTGTGCGGTTGTGTTCTCATTTTTATCCCATTGAGACTATTTATTTATG
TATGTATGTATTTATTTATTTATTGCCTGGAGTGTGAACTGTATTTATTTTAGCAGAGGA
GCCATGTCCTGCTGCTTCTGCAAAAAACTCAGAGTGGGGTGGGGAGCATGTTCATTTGTA
CCTCGAGTTTTAAACTGGTTCCTAGGGATGTGTGAGAATAAACTAGACTCTGAAC
aactgctttgttaccagtgtctcaatttgacttgggacttagtgaccattttaagggaga
ctggtgtgccacaaatcctgggtggcttgatcctgccacgtggatgctgtctgggtgagc
ttgttctcacactgccctcctgccacccccatttccagaaaggtgatgataaccctagca