Gene HRH2 Variant 1
DNA : 1.84 KbNT_023133
mRNA : 1845 bp NM_022304
CDS : 1080 bp NP_071640
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1845 bp
tgcctccccagtatgtatcctgattgcccaagtccctcccaaaaagaggtatccaaactg
gtcccatacttcctggggtcttgccaagaggttgagatctagtagaaggacacatcttga
attgggtcatgctttctatctggtttcaaggtgcttaacatccaacctttgccttttcag
CTCCTGCCCTCCACTGACTCCAGAGAGGGAGATCCCCAGTACTTGACTCCATCACGCAGA
TGGGAGCAGGCACCAGCTATGGAGAGGGATACAGCTGCGTCTCCACATGACCCATCCTGC
ATGACACCAAAGCCACCGCCAGACAGTGCCTCGGATTCTATGCAAAACCTGGGAAGCGGA
GACCTACCCCAGCCCCGGGAGGAAGCTAGCTCTTCAGGGGACCGTCTGAGGACTGGAGTT
TGATCCATGAACCTGGCTTCGAGGCCTTGCTTTTCTCTCTTCTTCATTCATATTCATTCC
CAACACCTTAGAAGGTGTTGCTTAATTTATTTCTAGAAAAGCAGCCCAGAGTCAGTCATT
GAAGCCTTCCCCACCCCCTGGCCAAAAAAAAAAAAAAAAAAAAACTGGACACATTTTGGA
TCTGTTGGGAGCTTGGAGTCCAGTGGTTGGCATAGTTGTCACATTGGGAGCAGAGAAGAA
GCAACCAGGGGCCCTGATCAGGGGACTGAGCCGTAGAGTCCCAGGATGGCACCCAATGGC
ACAGCCTCTTCCTTTTGCCTGGACTCTACCGCATGCAAGATCACCATCACCGTGGTCCTT
GCGGTCCTCATCCTCATCACCGTTGCTGGCAATGTGGTCGTCTGTCTGGCCGTGGGCTTG
AACCGCCGGCTCCGCAACCTGACCAATTGTTTCATCGTGTCCTTGGCTATCACTGACCTG
CTCCTCGGCCTCCTGGTGCTGCCCTTCTCTGCCATCTACCAGCTGTCCTGCAAGTGGAGC
TTTGGCAAGGTCTTCTGCAATATCTACACCAGCCTGGATGTGATGCTCTGCACAGCCTCC
ATTCTTAACCTCTTCATGATCAGCCTCGACCGGTACTGCGCTGTCATGGACCCACTGCGG
TACCCTGTGCTGGTCACCCCAGTTCGGGTCGCCATCTCTCTGGTCTTAATTTGGGTCATC
TCCATTACCCTGTCCTTTCTGTCTATCCACCTGGGGTGGAACAGCAGGAACGAGACCAGC
AAGGGCAATCATACCACCTCTAAGTGCAAAGTCCAGGTCAATGAAGTGTACGGGCTGGTG
GATGGGCTGGTCACCTTCTACCTCCCGCTACTGATCATGTGCATCACCTACTACCGCATC
TTCAAGGTCGCCCGGGATCAGGCCAAGAGGATCAATCACATTAGCTCCTGGAAGGCAGCC
ACCATCAGGGAGCACAAAGCCACAGTGACACTGGCCGCCGTCATGGGGGCCTTCATCATC
TGCTGGTTTCCCTACTTCACCGCGTTTGTGTACCGTGGGCTGAGAGGGGATGATGCCATC
AATGAGGTGTTAGAAGCCATCGTTCTGTGGCTGGGCTATGCCAACTCAGCCCTGAACCCC
ATCCTGTATGCTGCGCTGAACAGAGACTTCCGCACCGGGTACCAACAGCTCTTCTGCTGC
AGGCTGGCCAACCGCAACTCCCACAAAACTTCTCTGAGGTCCAACGCCTCTCAGCTGTCC
AGGACCCAAAGCCGAGAACCCAGGCAACAGGAAGAGAAACCCCTGAAGCTCCAGGTGTGG
AGTGGGACAGAAGTCACGGCCCCCCAGGGAGCCACAGACAGGTAATAGCCCTAGCCATTG
GTGCACAGGATGGGGGCAATGGGAGGGGATGCTACTGATGGGAATGATTAAGGGAGCTGC
TGTTTAGGTGGTGCTGGTTTATGTTCTAGGAACTCTTCATGAGCACTTTGTAAACACCCT
CTTGCTTAATCCTCCCAACGGCCCCCAAAGGTAGAACTTAGCTCCCTTTTAAAAGGAGCA
CATTAAAATTCTCAGAGGACTTGGCAAGGGCCGCACAGCTGGGGC
ctgaagagcggtcacctgacttcggaactcgcaagccctttttcccagctacgtggtcct
tacaattagaagtcttatgtttgaagcctgactgccactgaggagtcgtaagtgttcaac
caacccctccaggatagcactcaagtaaccatgtcaccaatgctgccacttgacgggcct