Gene FER Variant 1
DNA : 439.85 KbNT_034772
mRNA : 2950 bp NM_005246
CDS : 2469 bp NP_005237
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  179 bp
agggctgttctctacggttaaataaataaccctgcttagagaaaatattcaccactcttc
tttggctcctatgtaactcagtttttgagagggaggggaaataccggattgacgctatgt
ggttcaaccaatgcaaaagataacaccgccttaaaaagtctactacaggaacatgggagg
GTCACACCCTCGAATAATGACGCATACCTATCCTACTGTTACTGATCACCTAGTAATAAT
CTTGTAGTTCACATTACTCATTTTTCACCAAATTCTTTTGGTGAAGGACGCTTCAGAAAC
GGCCATCACTGAAGAGCAGACCCGTTTGGGTTCTCCACGCATTCTAGACTCCCGAAGAG
gtaagaatttattatagggggccactcccaggacctgctgtatgcttttaaacatccatt
acaattccagcattgagtttctaacatttttaggcaggctcaggcactgggagtacagga
ttgaaagacagttcccgtccttaagggactcagagtaaactggagttgctgaaaaccatt
EXON 2  146 bp
ggggagggagtaagcaatggatagataagttaggtaagtgtagcattcttatttttaacg
tagcaattgtcataagctgtcacagttaatttccaggaatagccaagtatactgaaagtg
tacatttttatctctttctctgtagtgaacagttctgactccttgaatttcttcttgcag
CTCATGTTTTTTGGCTAGACCTATGACCATTTTCGCTAGACTTCACTGCACGTTTTCTCA
AGTATCTTCTTTGTCCCTAATGTGTGACACCTCATCATGGACACGCTACTTTAGCTAAGG
CATGACCAGCAATGAACAGTAGTAAG
gtaggattactttattcttcttagtaagttactaaaccgttttttattttgggtctctga
aattgtgacttgtcttgattttgtagtattctttatgttagattattctactgtctatgt
aggctgttactgttttatatttgtgtttatttattttttgcttgtcatctatcccaatga
EXON 3  266 bp
gagtaatgttgaagccaacaatagggtggacttcttcatcttgtttctgatctttggaag
aaagtattcagttgtgttttttttttttaaccccaaagaagaatctatcataactttttt
ttttttgaagactaatttcctttttatttaagagtttttctcttttgtttacatacacag
ATATGTGCTGATTAGAAGGCTCACTTGTGCAGTGTGGAGGATAACCAGTGCCTTACAAAA
TGGGGTTTGGGAGTGACCTGAAGAATTCACATGAAGCAGTGTTAAAATTGCAAGACTGGG
AATTACGGTTACTGGAAACAGTAAAGAAATTTATGGCCCTGAGAATAAAAAGTGATAAAG
AATATGCATCTACTTTACAGAACCTTTGTAATCAAGTTGATAAGGAAAGTACTGTCCAAA
TGAATTATGTCAGCAACGTATCCAAG
gtaagaagaataatttcactctttgttatttataacattataattgtccttaaaatgcaa
tagctcaaactattgaatgagcatacttaagtcagcattctaaagcagtgattccacagt
tttacagagtatgaaaatctcatggagaagtttttaaaaattataaattttggagtggcc
EXON 4  174 bp
gaagttgaagacgttaaatatgaaccattcatagatctttgaacagttgccagaaaccta
ttttttatattaatgtaataatttacataaaactaaatatttaaagttttgaactcttaa
agcacagctaaatggaaacctttaatgcaaatgtttgtttcttttttttttttttttaag
TCTTGGCTACTTATGATTCAGCAGACAGAACAACTTAGTAGGATAATGAAGACACATGCA
GAGGACTTGAACTCTGGACCTTTACACAGGCTCACCATGATGATTAAGGACAAGCAGCAG
GTGAAGAAAAGTTACATAGGTGTTCATCAGCAGATAGAGGCAGAGATGATCAAG
gttcgtttttccatattgaagttctttcttgaaattgttttccaaattcacagaaatatt
ttaccttatttggctttaaaaattgtttattcatcatttcccaacaagaaataggtttat
ggtctctaataagtaatatcttattgaacataaaacattgattataggatatactgtgac
EXON 5  100 bp
ttgaatttagtactgatttttaaaacatacttgtagtttattttctatagttgtatatta
aaggacaactctgacctgtaagtagtgaaatacacatcagttaatactttggaatttaag
ttcttgagcaatttaaatttaaacaatttaatacatttatgcattttgtttctttgacag
GTTACCAAAACAGAATTGGAGAAGTTAAAATGCAGCTATAGACAATTAATAAAAGAAATG
AATTCTGCCAAAGAGAAATATAAAGAAGCTTTAGCTAAAG
gtaaggcaaaattttaaaaattgtttacttaggtgatttttattcttactgtttgaaagt
tatctttgtaagtagtggaatgattccatttagagcatttcacatataaaaaactcaaaa
taaacccacattggctaattgtcaaacagtgtagtaagtcttactaattttccattgctt
EXON 6  184 bp
tttgcaaatctaacagtaccttgcataaagctaagcacatattatgtgttcaataaaatt
tttttgtttaaaaaatgcgtgaaataacataaaacagtagtaattcagtttgtatgtagt
gaagatacaattttttttcttatctctttactaactttcttcagtttttttttttttcag
GGAAGGAAACTGAAAAGGCCAAGGAACGATACGACAAAGCCACAATGAAACTTCATATGT
TGCACAATCAGTATGTATTGGCGTTGAAAGGGGCACAGCTCCATCAGAATCAGTATTATG
ATATCACACTTCCCCTGCTTCTGGACTCCTTACAAAAGATGCAAGAAGAAATGATAAAAG
CACT
gtaagatacattttctttttatcataaaatcccttcacaaaatgatttcaacatattttc
tctctagtttaggtgttgcttcataagttttattattaacccagtccagggggtatttca
gaccttgattcttcttgattttcacttttcatgtcccttcagtttgtgcttatcccctaa
EXON 7  138 bp
ctgtacatttatataatccctcttctttactctccaggtatgaaataaggtggtacagga
aacaaccatctgtacatttcaacattacatttcttatgcttattgttctgaatccttttt
gagatagtatctctcttgataaaactttaaaatgctgcaaaattttatttttgttttcag
CAAAGGTATATTTGATGAATACAGCCAGATAACCAGTCTTGTCACAGAGGAAATAGTGAA
TGTCCATAAAGAGATTCAAATGTCGGTTGAACAGATAGATCCTAGTACAGAATACAATAA
TTTCATAGATGTTCACAG
gtatgacatgtttattcctctttaaggatttatgacagtattatttttcattcatacaat
agttaaccacagataaaaataagaaatacttaagatcttattaagacatagaatatttca
tattaatttatctgcttttaattttaaaagttctttgtcaatgatgataactatataatg
EXON 8  120 bp
ggaatctaagtctcaagttacacaattttgaaacccaggatttagtttgatttatactat
ttgtgttttctttgttaacataattttggataaaaacaaatattctgcctttagtgtata
tgaagatatattatgatactgtatttacaatgatcaaaattatttgccatgctttactag
AACAACGGCTGCTAAAGAACAAGAAATAGAGTTTGATACTTCCTTACTGGAAGAAAATGA
AAATCTTCAGGCAAATGAGATCATGTGGAATAACTTAACAGCAGAAAGTTTGCAAGTAAT

gtaagtattcacaaaatatcaacagtttaaatactagtattattattgctttattgttgt
actcagatttaaaatatcaattatttttacaagtattgaacagtaaatttttggggtcag
agtgacatgttttgagaaatatgttaattttactcattttcgtcactacttttggtaatt
EXON 9  123 bp
tgtttagcacctgaaatgtgtctaatgcaaccaaagagctgaaattttattttagtttga
atcagattatatgtggctactgttttggacattgcaacataagatgtatgaatacttttt
tgatatgtataaagtgaaaattaatttgttggttgttattgaggatactgtttattctag
GTTGAAAACGTTAGCGGAAGAACTTATGCAAACACAGCAGATGCTTTTAAACAAGGAGGA
GGCTGTTTTGGAGTTAGAGAAGAGAATTGAAGAATCTTCTGAAACTTGTGAGAAGAAGTC
TGA
gtgagtaaaagagaaacaatttgaaggaagaatgtttaattgtaattttacaaaaatatt
ttagttacatggcagtgtgaacctaacatttctagaaacagaaacttttattttaagtat
gaagttttgtatagttaatttctaggattctggaaaaatgattctgtggttttaaaaaat
EXON 10  190 bp
tgttaatgctagcatgtaataaatactgtgataacttaaaatctgcttagtttcatattt
tttatgattctaaagggctcttataaaaatgaaatcaaagaaaagcataatttacatata
tgaggtttccttaatgtcttcttaatgaagttgaaatcatttatatttattctcttttag
TATTGTGCTTCTGCTAAGCCAAAAACAGGCACTTGAAGAACTGAAACAGTCAGTCCAGCA
GCTGAGATGCACTGAAGCAAAGTTTTCAGCACAGAAGGAATTACTAGAGCAAAAAGTGCA
AGAAAATGATGGGAAAGAGCCACCTCCAGTAGTAAATTATGAAGAAGATGCACGATCAGT
TACATCTATG
gtaagctaaagaataatccaatgagaaacttggaagagtagtgtctaggtaataagtgca
tacaaaaattatttaaatttgctataacaaattgttactcttgttaatatgcaggtccta
ttaaacttgtttgtaaatgcaaaatagacttgtcagtcacctcaggtcacctggagagca
EXON 11  93 bp
gtaaaatgctatagagtttatgtgtatttggttatttgttatcttgaatgtcaggaagtt
tatattttatttagttggaagacatgatggataagctgtggataagtacctaaatacata
aatgtctatacatattggatagtttactgttgctgaaggcttgtttcttaatccctccag
GAAAGAAAGGAGAGGCTATCCAAATTTGAATCTATTCGTCATTCAATTGCTGGAATAATT
AGGTCTCCAAAATCTGCACTGGGCTCTTCAGCA
gtaagtaggattaactctctgtgctactgaaaatggtcattgtctagcttctttctgatg
cactaatgaatatatatatatgtgtgtgtgtgtgtatatatatgtatatacatatataaa
tttgcacttacaaatggaaagataagtgcataatttaactttttgtgtgcatatgaatct
EXON 12  204 bp
atttgtggtaaacttcagcaccagtacttcaaaagatattttaggtttattgtataactt
ttaattggtcaattaaagggaggaacatttgtaagaagcctttatagttgctatgaattt
tattagaaaataatcagtattttctctaatttagttttttttttttaatatttgtttaag
CTTTCTGATATGATCTCCATCAGTGAGAAGCCTTTGGCAGAACAGGACTGGTACCATGGT
GCAATTCCCAGAATAGAAGCTCAAGAACTGTTAAAAAAACAAGGAGACTTTTTGGTGCGA
GAGAGTCATGGGAAACCTGGTGAATATGTCCTTTCTGTATATTCTGATGGACAGAGGAGA
CATTTTATCATACAATATGTTGAT
gtacgtttccagtttagttcatatgtatattttgatgtagttcattgcggtacaattata
ttaaaataacgaatggtttgtgataaatgcctgcaacacttgaaatttagcacttaattt
ttttctgaatttcttaaatacagtgcttcaaaatgtactaacatttaaatatgtttaagg
EXON 13  123 bp
ttatctatttatatttttatcatcttaaccatttttaagggtatagttcagtagtgttaa
gtatattcacattgttgtgcaattatagtttttttaagaaaggaatctaatttatcaatg
aatgtagattttctaaagcaatgtcttcacatttattctaccttattgttctctctccag
AACATGTATCGATTCGAGGGCACTGGGTTTTCAAACATTCCTCAACTTATAGATCATCAC
TATACAACAAAACAGGTCATCACTAAGAAATCAGGTGTAGTTCTGCTGAATCCTATTCCT
AAG
gtaggtgcttatatacttttttgtctgtttgttttaaaagaatttttggtgagttaacat
ttccaacagtaaataaaattcttaggttatatgctagtagttcagaaaaaaagttttgtt
tttgtttttctagcttttattactaatgcaattgaaacatgaaacttccttgattttatt
EXON 14  57 bp
gtgtagtaccgtttcttaaatttgttttacagcatcttggggttataacttctcagtgtg
ctgttgattgaatggtctgaatgaaatatccctttaggtcgactttccactggctcaaat
gcaacttcaagaagtgtacccttgcttgtactaaacaactgttcttattctttgctgtag
GACAAGAAATGGATTCTCAGTCATGAAGATGTCATATTGGGAGAATTACTGGGCAAG
gtatgtaatcaactgagctaaataaccagaagtctctatattgattgtgaagactgcaga
ttttttcattttcctcaaagcttttcttatattgccacaaggcacattacacattaacta
gaacacaatgctatatcttctcaatattgtgatgctcactgaaatagatgtgtgaaagtc
EXON 15  116 bp
acaatatgtcctagccatagagtaaagttagaagttcgtatgtctgatagaaattagttc
atcactggtgatattgacatgtaggtaagcacctcctcctctttggtacctttccttgta
tttggcaaagatatacatgctgtcatttaccccagacaatgaatgtatttctattttcag
GGAAATTTTGGTGAAGTATATAAGGGCACATTAAAGGATAAAACTTCTGTTGCTGTTAAA
ACATGTAAAGAAGATCTTCCTCAGGAATTGAAAATAAAATTTTTACAAGAAGCCAA
gtgagttatttaaagtaatcaaaatatgtatttattatgtaaattatttattaaaatgta
agtttgaagacatcttaaattgtgatttactgaaatagtaggggtaagcacttttacagt
atggaatccaaaaatttgtgcttttgtgatattctgcagatcaattcagcaatcatagtc
EXON 16  95 bp
tactgagggaaggctttactcgtttgtatacatccaatttatcataatttggggtcatac
tgaaattttaaaaattgaattatgattcaagagtattctagttgtaaaccctatttgtga
tcacaaattaatgctttattattcaaatgataactattcgtatattttcatctcatctag
AATTCTCAAGCAATATGATCATCCCAATATTGTCAAACTTATAGGAGTTTGCACACAAAG
ACAGCCTGTCTACATCATTATGGAACTGGTTTCAG
gtaatgtgatctgagaatttttgcatgatgacattttaatgtcatgttttattgttttta
tatgttcgatctctttgatttctcctcgtaaagtctccaaggattttgtttaacatttcc
agataacaaaagagtctgtacctatagtcagtatttttataggctgtaacactttactat
EXON 17  124 bp
ctaatatgttgtgttcttttcatgttttctgttatcctcacgtcaaacaaattgggcaaa
aagcatggccaaatgtgtaatgcattttgctctgtcaaatattcctaatagatccaaata
gatgataaatgtgactttcatcataactttgtctcattgttcatctatcaattcctctag
GAGGTGATTTCCTCACCTTTCTGAGAAGGAAGAAGGATGAACTAAAACTCAAACAGTTAG
TGAAATTTTCATTAGACGCTGCTGCTGGTATGTTGTATCTCGAGAGTAAAAACTGTATAC
ACAG
gtaaggagaacatttttaaagcaatttttggttttattaatagaatgctggaaaactgat
gtatttgctacaatagaagtcattttctttcatgaaacatgtcttttcttgttttctgta
ttttgtgtgaaagtgtcctctgctagttgtttatatagtttatacaaacactcctttttc
EXON 18  155 bp
atgttctcatggatgttttttacctatgacagaaaagatgaggactggtaaatcacaagc
attcttaacctcattataaatacattgcaaatgtaaaaatgcaaagtgtggaaatcataa
atgtgaaagtggctttcaatttgttttaataggcgttttctgtgtcttactgtaacctag
GGACCTTGCTGCAAGAAACTGCCTGGTAGGTGAAAATAATGTTCTGAAAATCAGTGACTT
TGGAATGTCTCGTCAAGAGGATGGTGGAGTGTATTCATCTTCTGGCTTAAAGCAGATTCC
CATTAAATGGACAGCACCGGAAGCTCTTAATTATG
gtaagaatagaccacattttttttttaatggtaaaaatgaacggcatcagcataaaacat
tcacaagcaatatttacaggggtagcacagaatgcaagttagaatgatttgaggatcaac
acaaataagtgaatttcatacttttaatttgttgaaattattgatcagatttctatatgt
EXON 19  123 bp
catcactaggcaataggaattttttagctccattatactgggaccactgtcatatatgtg
ctccatcattgaccaaacatcattatgtggtgcatgactgacacagacatacataaccag
gaagggtcacctacttgtctactgtgcctcatgtggttatggttgttgttcctcttccag
GGAGATACAGTTCAGAGAGTGACGTGTGGAGCTTTGGCATCCTTCTCTGGGAGACCTTCA
GCTTAGGGGTTTGTCCGTACCCTGGAATGACAAATCAGCAAGCAAGAGAGCAAGTAGAAA
GAG
gtgagccaagtacattcattgttagtgttcatgtccagccccaggggtaggcagtgctta
tagtgtgtctgcttgaggaggggtgtgttaaatactgtttggttgtgttatgagaccatc
tctggggttcagaagcagatttatctaacatctctgctctttatccaaacactttgaagg
EXON 20  240 bp
aatattgaattctgcatcacctgtagaaaataaaaactcagcctccccagaaatggatgt
tttgtttccatataactacaacataaggtaccaaaagttaataactgcataatgccctgt
gtgaacattttgtgtcttacctccattctaaattctgttctccttctcttgggtcttcag
GATACCGGATGTCAGCTCCCCAGCACTGTCCAGAGGATATTTCCAAAATCATGATGAAGT
GTTGGGATTATAAACCTGAAAATCGCCCTAAGTTCAGTGAACTTCAGAAAGAGCTCACTA
TCATCAAGAGAAAACTCACATAGTGACAGGATGGCGCCAAACTCAGCCTTCAGGACTCTG
TCCTCCAGCAGAGTAACATTATTGTTCTCATTAACAATGAATTTATACCACATTACCTTC

gacagtcttctaccattattttttattaactgggtgttttaaaagtacgttccacttgta
aaaagtcaaaggcaaatttgttaaagaaataggcagtcctaccaagggctttcttagcta
accatagcaatcctaccatttcaggccattgcaaatagaaaagcacaggcttctaagtgt