Gene F12 Variant 1
DNA : 7.44 KbNT_023133
mRNA : 2049 bp NM_000505
CDS : 1848 bp NP_000496
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  106 bp
tagaaaagagaggaggagcccagctcttcatttcacccccacccacaaactcccaacttt
ccggccctcaaggggtgaccaaggaagttgctccacttggctttccacaaacagcctgtg
ccccaccaggctcaggagggcagcttgaccaatctctatttccaagacctttggccagtc
CTATTGATCTGGACTCCTGGATAGGCAGCTGGACCAACGGACGGACGCCATGAGGGCTCT
GCTGCTCCTGGGGTTCCTGCTGGTGAGCTTGGAGTCAACACTTTCG
gtgagtgctgtgggaaccaggattgtcccaggattgttctggggggtcgctatcacagcc
atgagccatggcctctgctcatgacctgtgggtccaggtgactaggaggcctatgtggaa
aggtgaggccagcccggaaggcccaggcagaggagacagacaaccagaccgggtggatac
EXON 2  58 bp
cagcctgcatttctgggggagatgggccttaagaagacaacggggggaggtagaaagggt
ttgggtcttgggaagaaatctctgcatttctgggctgtgagaggaagctgcagactagca
acagatcggtggcaggctatgacttatagtcagttccctgccttcttctctcccttgtag
ATTCCACCTTGGGAAGCCCCCAAGGAGCATAAGTACAAAGCTGAAGAGCACACAGTCG
gtaagtggcctggctcctcctcccgggaacccttgggtggggatgtgtatggtgcagtgt
gtgcagtctcagggcagtctagtctagtgcctacctggtgctaggtcttatgcccatggg
cactagagtgatcgtgagctgtgtgatccttgagggcagggtatgggctgtgtctaagtg
EXON 3  100 bp
gctgggattacaggcttgagccaccgcgcccggccctgaacccaacttttagagcagaaa
gtgttttcaatgcacagcgacctttttgagggtctgtccttttcctgaccagaccctgag
ggacagtgcctgagcagttgagtacaggggaagtcctcagagagtgtgttgtccctgcag
TTCTCACTGTCACCGGGGAGCCCTGCCACTTCCCCTTCCAGTACCACCGGCAGCTGTACC
ACAAATGTACCCACAAGGGCCGGCCAGGCCCTCAGCCCTG
gtaagactacgcagaggagttggagcaggggcctgggagacatgtaccctgcctgtcctt
ctgtccaaggaactctgcttggagagaggggactgtgatagggcagggtgggccaggccc
ctgggtagagcagggaagccttgtctctttctacaggtgtgctaccacccccaactttga
EXON 4  71 bp
gggccggccaggccctcagccctggtaagactacgcagaggagttggagcaggggcctgg
gagacatgtaccctgcctgtccttctgtccaaggaactctgcttggagagaggggactgt
gatagggcagggtgggccaggcccctgggtagagcagggaagccttgtctctttctacag
GTGTGCTACCACCCCCAACTTTGATCAGGACCAGCGATGGGGATACTGTTTGGAGCCCAA
GAAAGTGAAAG
gtgctacacacagcctctggggtggcctggggctctctcctcccgcctcattactctcct
ggtatcaccagaccccacacacctgggattctggacccagccccttctctccctccacaa
taccctttggaagtccagagggagagttctgggaaggagtggtcccattttgcaggtggg
EXON 5  111 bp
accctttggaagtccagagggagagttctgggaaggagtggtcccattttgcaggtgggt
aaaccaagcttggaaacttggagtagcaaggtcacaaggcaagtaggttcaagaagggcc
ttggcccccagctgtgtgactcagctccctgctcttccttccaccatgtccatctctcag
ACCACTGCAGCAAACACAGCCCCTGCCAGAAAGGAGGGACCTGTGTGAACATGCCAAGCG
GCCCCCACTGTCTCTGTCCACAACACCTCACTGGAAACCACTGCCAGAAAG
gtgaggagatgtggaggacctgggcggggtgctgggggacaggggcaaccctgggcctac
agaataggttgctggatactcggagacttggcatggtcctagactctcctgagaccacta
tccctctttgtccccagagaagtgctttgagcctcagcttctccggtttttccacaagaa
EXON 6  132 bp
tgtctctgtccacaacacctcactggaaaccactgccagaaaggtgaggagatgtggagg
acctgggcggggtgctgggggacaggggcaaccctgggcctacagaataggttgctggat
actcggagacttggcatggtcctagactctcctgagaccactatccctctttgtccccag
AGAAGTGCTTTGAGCCTCAGCTTCTCCGGTTTTTCCACAAGAATGAGATATGGTATAGAA
CTGAGCAAGCAGCTGTGGCCAGATGCCAGTGCAAGGGTCCTGATGCCCACTGCCAGCGGC
TGGCCAGCCAGG
gtgagcagatggttgggaacggaccagggaggagcgtcaggaagacaggctggcaggagg
ccgggtggtgtgccgggaaggagagctctctgggggggtctttaggcccaggggtggctc
actgcgttccctccccaagcctgccgcaccaacccgtgcctccatgggggtcgctgccta
EXON 7  105 bp
caagggtcctgatgcccactgccagcggctggccagccagggtgagcagatggttgggaa
cggaccagggaggagcgtcaggaagacaggctggcaggaggccgggtggtgtgccgggaa
ggagagctctctgggggggtctttaggcccaggggtggctcactgcgttccctccccaag
CCTGCCGCACCAACCCGTGCCTCCATGGGGGTCGCTGCCTAGAGGTGGAGGGCCACCGCC
TGTGCCACTGCCCGGTGGGCTACACCGGACCCTTCTGCGACGTGG
gtgagtgagggtctggggcaagcagaaggccagcccccaggtgggacgggcttgccagga
aggaggagggagagtgcggaaagcagatgagagggaggcaggagagcccagccttggctg
cccagggagccccctttctcctcagacaccaaggcaagctgctatgatggccgcgggctc
EXON 8  166 bp
cccggtgggctacaccggacccttctgcgacgtgggtgagtgagggtctggggcaagcag
aaggccagcccccaggtgggacgggcttgccaggaaggaggagggagagtgcggaaagca
gatgagagggaggcaggagagcccagccttggctgcccagggagccccctttctcctcag
ACACCAAGGCAAGCTGCTATGATGGCCGCGGGCTCAGCTACCGCGGCCTGGCCAGGACCA
CGCTCTCGGGTGCGCCCTGTCAGCCGTGGGCCTCGGAGGCCACCTACCGGAACGTGACTG
CCGAGCAAGCGCGGAACTGGGGACTGGGCGGCCACGCCTTCTGCCG
gtgcgccgcgtggggctgggtgacccctccgccccagggctccgggctcccggcgctcta
acggcgccccgtcgtgtggctacaggaacccggacaacgacatccgcccgtggtgcttcg
tgctgaaccgcgaccggctgagctgggagtactgcgacctggcacagtgccagaccccaa
EXON 9  218 bp
gcgccctgtcagccgtgggcctcggaggccacctaccggaacgtgactgccgagcaagcg
cggaactggggactgggcggccacgccttctgccggtgcgccgcgtggggctgggtgacc
cctccgccccagggctccgggctcccggcgctctaacggcgccccgtcgtgtggctacag
GAACCCGGACAACGACATCCGCCCGTGGTGCTTCGTGCTGAACCGCGACCGGCTGAGCTG
GGAGTACTGCGACCTGGCACAGTGCCAGACCCCAACCCAGGCGGCGCCTCCGACCCCGGT
GTCCCCTAGGCTTCATGTCCCACTCATGCCCGCGCAGCCGGCACCGCCGAAGCCTCAGCC
CACGACCCGGACCCCGCCTCAGTCCCAGACCCCGGGAG
gttaggaagtggggggggaaggaggagccgagagggcgccgggcgagctagattccggcc
agccggccgcgggctccccgtcctcagcccctgctcctccacagccttgccggcgaagcg
ggagcagccgccttccctgaccaggaacggcccactgagctgcgggcagcggctccgcaa
EXON 10  232 bp
ctcatgcccgcgcagccggcaccgccgaagcctcagcccacgacccggaccccgcctcag
tcccagaccccgggaggttaggaagtggggggggaaggaggagccgagagggcgccgggc
gagctagattccggccagccggccgcgggctccccgtcctcagcccctgctcctccacag
CCTTGCCGGCGAAGCGGGAGCAGCCGCCTTCCCTGACCAGGAACGGCCCACTGAGCTGCG
GGCAGCGGCTCCGCAAGAGTCTGTCTTCGATGACCCGCGTCGTTGGCGGGCTGGTGGCGC
TACGCGGGGCGCACCCCTACATCGCCGCGCTGTACTGGGGCCACAGTTTCTGCGCCGGCA
GCCTCATCGCCCCCTGCTGGGTGCTGACGGCCGCTCACTGCCTGCAGGACCG
gcgagtacccgcccgcccagagccgccccaggggccgcggctcctccgtctcccagcgca
gcttccacgctgcacccgaacccgtgccctaccttctcccgccccacccttctttccacg
cccctccggagctcccggggaggaagctggaacacgggattggggttcgggagcaggggg
EXON 11  137 bp
cttccacgctgcacccgaacccgtgccctaccttctcccgccccacccttctttccacgc
ccctccggagctcccggggaggaagctggaacacgggattggggttcgggagcagggggc
ttccccagaacgcttgtggccaggtctgagagcgctgcctctcccctaccccccccgcag
GCCCGCACCCGAGGATCTGACGGTGGTGCTCGGCCAGGAACGCCGTAACCACAGCTGTGA
GCCGTGCCAGACGTTGGCCGTGCGCTCCTACCGCTTGCACGAGGCCTTCTCGCCCGTCAG
CTACCAGCACGACCTGG
gtgcgtgggggcgccccgcggggacgggaagagagcttggggccccggcgtccccgcctc
acgctcctctccgcccgggttagctctgttgcgccttcaggaggatgcggacggcagctg
cgcgctcctgtcgccttacgttcagccggtgtgcctgccaagcggcgccgcgcgaccctc
EXON 12  144 bp
cgccgtaaccacagctgtgagccgtgccagacgttggccgtgcgctcctaccgcttgcac
gaggccttctcgcccgtcagctaccagcacgacctgggtgcgtgggggcgccccgcgggg
acgggaagagagcttggggccccggcgtccccgcctcacgctcctctccgcccgggttag
CTCTGTTGCGCCTTCAGGAGGATGCGGACGGCAGCTGCGCGCTCCTGTCGCCTTACGTTC
AGCCGGTGTGCCTGCCAAGCGGCGCCGCGCGACCCTCCGAGACCACGCTCTGCCAGGTGG
CCGGCTGGGGCCACCAGTTCGAGG
gtaggcacaactgctaggggcaggggtaggggaggagacctttgatcactgggttaggcg
gaagaagcccgcgactttggtatcgttccgggtgcctacagaatgggtggcgctgacctg
atgggttgtgagaatgtgtaggtgaatcccaggtagaatcccagggcctgggattcactg
EXON 13  149 bp
ttctctggacctcagcctccttgcctatgaaattgaattaatggcacctcctccccttcg
ggcttgctgcgagagaggaagggcatgagtgggtttacaagcgcctggagcagctttgtc
catcgtccgggcggcaagcgttgtcagatggggtgtgaagaaggcgctctgtgttcgcag
GGGCGGAGGAATATGCCAGCTTCCTGCAGGAGGCGCAGGTACCGTTCCTCTCCCTGGAGC
GCTGCTCAGCCCCGGACGTGCACGGATCCTCCATCCTCCCCGGCATGCTCTGCGCAGGGT
TCCTCGAGGGCGGCACCGATGCGTGCCAG
gtgagctcttagcccggttggcgcccttccccgaggccgtcaggcacaaatctcaggtcc
acagcgctgagctgcgtgtttccgacccagggtgattccggaggcccgctggtgtgtgag
gaccaagctgcagagcgccggctcaccctgcaaggcatcatcagctggggatcgggctgt
EXON 14  320 bp
cgctgctcagccccggacgtgcacggatcctccatcctccccggcatgctctgcgcaggg
ttcctcgagggcggcaccgatgcgtgccaggtgagctcttagcccggttggcgcccttcc
ccgaggccgtcaggcacaaatctcaggtccacagcgctgagctgcgtgtttccgacccag
GGTGATTCCGGAGGCCCGCTGGTGTGTGAGGACCAAGCTGCAGAGCGCCGGCTCACCCTG
CAAGGCATCATCAGCTGGGGATCGGGCTGTGGTGACCGCAACAAGCCAGGCGTCTACACC
GATGTGGCCTACTACCTGGCCTGGATCCGGGAGCACACCGTTTCCTGATTGCTCAGGGAC
TCATCTTTCCCTCCTTGGTGATTCCGCAGTGAGAGAGTGGCTGGGGCATGGAAGGCAAGA
TTGTGTCCCATTCCCCCAGTGCGGCCAGCTCCGCGCCAGGATGGCGCAGGAACTCAATAA
AGTGCTTTGAAAATGCTGAG
aaggaaagctcttttcttcatgggtcccgccgggaaatgccaagacagaaaagcgattca
cagcttctccacagctctcagagaacaaggtctatgagatcttaacgtgcaaaatctaga
tgccagcccagctaatgtttactgagcctaggatactgtataccaagccctgtgcaagga