Gene CMYA5 Variant 1
DNA : 63.14 KbNT_006713
mRNA : 4497 bp NM_153610
CDS : 3490 bp NP_705838
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  2318 bp
aagttttggtggagaaaactaagactttcctgccagtggttctttcttgtcatgatgaaa
tagagaaccactctttgtctcaggaaggaaatctagtgttagaaaagtcaagcagagata
tgccagatcacagtgaagaaaaagaacagttcaaagagtcagagctatggaaaggtggtt
CAGTAGATATCACAAAAGAAAGTATGAAAGAAGGATTTCCATCTAAAGAATCCGAAAGGA
CTTTAGCTCGTCCTTTTGATGAAACTAAGAGCTCAGAAACACCGCCATATTTGCTGTCAC
CTGTAAAACCACAAACTCTTGCTTCAGGAGCTTCTCCAGAAATTAACGCAGTGAAGAAAA
AAGAAATGCCACGATCAGAATTGACTCCAGAAAGGCATACAGTTCATACTATTCAGACAT
CTAAAGATGACACATCCGATGTGCCTAAACAATCTGTTCTTGTTTCAAAGCACCACTTGG
AGGCTGCGGAAGATACCCGTGTAAAGGAACCACTGTCTTCAGCAAAAAGCAACTATGCTC
AATTTATATCTAATACATCAGCAAGCAATGCTGATAAAATGGTTTCTAATAAAGAAATGC
CCAAGGAACCTGAAGACACATATGCAAAAGGTGAAGACTTTACAGTGACTAGTAAGCCAG
CCGGACTTTCAGAAGATCAGAAGACTGCCTTTAGTATCATTTCTGAAGGCTGTGAGATAT
TGAATATTCATGCTCCGGCCTTTATTTCTTCAATCGATCAGGAAGAAAGTGAACAAATGC
AAGATAAATTAGAATATTTGGAAGAGAAAGCCTCATTTAAAACCATACCACTCCCTGATG
ATAGTGAAACAGTTGCTTGTCATAAAACATTAAAGAGCAGGTTAGAAGATGAAAAAGTTA
CCCCATTGAAAGAAAATAAACAAAAGGAAACTCATAAGACAAAAGAAGAGATATCCACAG
ATTCAGAAACTGATTTATCATTTATTCAGCCCACAATTCCCAGTGAAGAGGATTATTTTG
AAAAATATACTTTGATTGATTATAACATCTCCCCAGACCCAGAAAAACAGAAAGCTCCAC
AGAAATTAAATGTTGAAGAGAAACTCTCAAAGGAAGTTACAGAAGAAACTATCTCTTTCC
CAGTAAGTTCAGTGGAAAGTGCACTAGAACATGAATATGACTTGGTGAAATTAGATGAAA
GTTTTTATGGACCAGAAAAGGGCCACAACATATTATCTCATCCAGAGACCCAAAGCCAAA
ACTCAGCTGACAGGAATGTTTCAAAGGACACAAAGAGAGATGTGGACTCAAAGTCACCGG
GGATGCCTTTATTTGAAGCAGAGGAAGGAGTTCTATCACGAACCCAGATATTTCCTACCA
CTATTAAAGTCATTGATCCAGAATTTCTGGAGGAGCCACCTGCACTTGCATTTTTATATA
AGGATCTGTATGAAGAAGCAGTTGGAGAGAAAAAGAAGGAAGAGGAGACAGCTTCTGAAG
GTGACAGTGTGAATTCTGAGGCATCATTTCCCAGCAGAAATTCTGACACTGATGATGGAA
CAGGAATATATTTTGAGAAGTACATACTCAAAGATGACATTCTCCATGACACATCTCTAA
CTCAAAAGGACCAGGGCCAAGGTCTGGAAGAAAAACGAGTTGGTAAGGATGATTCATACC
AACCGATAGCTGCAGAAGGGGAAATTTGGGGAAAGTTTGGAACTATTTGCAGGGAGAAGA
GTCTGGAAGAACAGAAAGGTGTTTATGGGGAAGGAGAATCAGTAGACCATGTGGAGACCG
TTGGTAACGTAGCGATGCAGAAGAAAGCTCCCATCACAGAGGACGTCAGAGTGGCTACCC
AGAAAATAAGTTATGCGGTTCCATTTGAAGACACCCATCATGTTCTGGAGCGTGCAGATG
AAGCAGGCAGTCACGGTAATGAAGTCGGAAATGCAAGTCCAGAGGTCAATCTGAATGTCC
CAGTACAAGTGTCCTTCCCGGAGGAAGAATTTGCATCTGGTGCAACTCATGTTCAAGAAA
CATCACTAGAAGAACCTAAAATCCTGGTCCCACCTGAGCCAAGTGAAGAGAGGCTCCGTA
ATAGCCCTGTTCAGGATGAGTATGAATTTACAGAATCCCTGCATAATGAAGTGGTTCCTC
AAGACATATTATCAGAAGAACTGTCTTCAGAATCCACACCTGAAGATGTCTTATCTCAAG
GAAAGGAATCCTTTGAGCACATCAGTGAAAATGAATTTGCGAGTGAGGCAGAACAAAGTA
CACCTGCTGAACAAAAAGAGTTGGGCAGCGAGAGGAAAGAAGAAGACCAATTATCATCTG
AGGTAGTAACTGAAAAGGCACAAAAAGAGCTGAAAAAGTCCCAGATTGACACATACTGTT
ACACCTGCAAATGTCCAATTTCTGCCACTGACAAGGTGTTTGGCACCCACAAAGACCATG
AAGTTTCAACGCTTGACACAGCTATAAGTGCTGTAAAG
gtaaatagatgttgaacacacataattaataatatatatatacacatttaatttgctttt
acattttctcaattttaaagatgattaatatttgatcattgatctttaagcagaatggtc
tgaaagcaaactaagaatatttctccaagaatttagttaaggtaggcttgacagacattc
EXON 2  96 bp
atacagaattatctatagtcagatgaggcagtaaagaaaatttaaggattgatttgttag
tggatatagtatagtaagtctctacgaaacatactaaatttataaggaacttggagctca
ctggttgaagttctcttcctaaatgtcatatactaaggatatcttaattcttttcttcag
GTTCAATTAGCAGAATTTCTAGAAAATTTACAAGAAAAGTCCTTGAGGATTGAAGCCTTT
GTTAGTGAGATAGAATCCTTTTTTAATACCATTGAG
gtaagttaacacacccattttaccttaacctggcttgttcacagtatcagaagtaaatga
ttctgaggtgaagggatctgacttggggattttatgcgcatgtgttgtttgccattgttg
gttcggttccattcaaagcgagaatgcttaaagtcttctctctgtgcataatgagtgaga
EXON 3  234 bp
caaaactaactgtgggaaagggattggtaggttagaaatttgaactgtgcatgtgatgtc
tgattctctgatcaggatgccagaggtcaattctttaaaaggctggtgtttccaaaaaaa
aaaaaaagcagcatttcttgtttcattcagaagtgggcttttttgcttgtttgttttcag
GAAAACTGTAGTAAAAATGAGAAAAGGCTAGAAGAACAGAATGAGGAAATGATGAAGAAG
GTTTTAGCACAGTATGATGAGAAAGCCCAGAGCTTTGAGGAAGTGAAGAAGAAGAAGATG
GAGTTCCTGCATGAGCAGATGGTCCACTTTCTGCAGAGCATGGACACTGCCAAAGACACC
CTGGAGACCATCGTGAGAGAAGCAGAGGAGCTTGATGAGGCCGTCTTCCTGACT
gtaagtgccaagtaaaatgggctcaaacaccttgcgcccactctggcacatctactttta
aagcttcatttttcactattccttaagattatttatatctctgtgtgggatttatataat
tctggcatttaaacattatttgggcatgcctgatgcctatagaaaaggcccagcaaaccc
EXON 4  23 bp
cttgctgcccagactgagacaaaaacaacctcagggaagctgaggggttatgattttcaa
acgtgggtaatcttaatgctcctggttgttttttctttctgttgttaattagcttctctc
tctctttctctctctctttttctctcttctcctcctccttcctctctctttctccctaag
TCGTTTGAGGAAATCAATGAAAG
gtatataaaacatgatacaatgtagtggcaaacagcatgactggatgcttgctttttaat
attttggtgctttatggaaaatgagctgccaattaaaaaatgcatttagtgggctacagt
attttcacttttagacacagtgcttttaaaagctaaatgacagctttgaaagaaaactgc
EXON 5  119 bp
tagattttagacatatatttcaagactttaaagctttaaatccttttttggatagagtga
gaggccctgccttatgcaaaccaccactaccaacaccagcttcattttgaacaatttttt
tcactttcattctgtatgttaataattttttaacttatgtagagctctattccccgatag
GTTGCTTTCTGCAATGGAGAGCACTGCTTCTTTAGAGAAAATGCCTGCTGCGTTTTCCCT
TTTCGAACATTATGATGACAGCTCGGCAAGAAGTGACCAGATGTTAAAACAAGTGGCTG
gtaagcattttaatatattaattacctagatgaaatatggcagtttttgcttgtttgttt
tgtatgtaatgatatatacaaaagattttgagtgtaaagacatgtaactggaaaaagaaa
agtattagttgtaaaatgttacagctagactctgaaattgagcatgggaggaacatccca
EXON 6  150 bp
taaaataaaaaataaaaaaatataattggggttgggggtttgggggaacaagagagccct
tctacttttatactatgtatttctgtattctttgaatatttttcaacaagcataagtaac
ttgtgcccaaaaaattaataaaaacagcattagttacaataaaacttgtttatattccag
TTCCACAGCCTCCTAGATTAGAACCTCAGGAACCAAATTCTGCCACCAGCACAACAATTG
CAGTTTACTGGAGCATGAACAAGGAAGATGTCATTGATTCATTTCAGGTTTACTGCATGG
AGGAGCCACAAGATGATCAAGAAGTAAATG
gtaggattgctaacacaaatacaaatgcatatgcatattcatgcatcttcatgtgaagta
tttaaatatacacctgtattatgactcttcccacaaagcatttatagccatttacaaaac
aacaacaaaaccccaacaaccatataatgaaataataactacagaagcaaaatttgggaa
EXON 7  147 bp
ttttcagaatgctgttgctttcacatgtattctaaggagctggttttcacataatggtat
ctgtaaggttatcagtttgcattttccactgaaagaaaatcatagatgactttctccagt
aactataacttttaattaactttggaagatgtcttcgattttaattgtgtcttatgctag
AGTTGGTAGAAGAATACAGACTGACAGTGAAAGAAAGCTACTGCATTTTTGAAGATCTGG
AACCTGACCGATGCTATCAAGTGTGGGTGATGGCTGTGAACTTCACTGGATGTAGCCTGC
CCAGTGAAAGGGCCATCTTTAGGACAG
gtaaggagatggatgctaagggtgcattagaagacaacgctcagttcttcacagactctt
gagatcagccagtaagtgtttattaagcacctattgtgtgttgagtgttgtgcaaagtgc
tggttatacaacgatgacttaagcctggggtcctgttctcaagaagctcatgctcaggtg
EXON 8  148 bp
gaagggagagagacatcaccatctatatttgatcccttttgggtttttaacacagaatac
actttctgatgaaaaattgaaaacagaatcatgccgaagccgtggaagatcacgtgcttc
tcaggtcccaggaaagcaagctggcattgctccacgactgtcctgactctctttctgcag
CACCCTCCACCCCTGTGATCCGCGCTGAGGACTGTACTGTGTGTTGGAACACAGCCACTA
TCCGATGGCGGCCCACCACCCCAGAGGCCACGGAGACCTACACTCTGGAGTACTGCAGAC
AGCACTCTCCTGAGGGAGAGGGCCTCAG
gtgaggggccctctccatgggagagactgcccagagcccagtaaccaagctctgggtcct
aaactaccctctaacttctgctcaccaagggagaaatgccgtctaaaatcctgctgagct
aatgaagccgctgacttgatttgcagctctatcacagttcaccaatgaactccaagtttg
EXON 9  132 bp
atcttagtggacaatggccattttgtaggacctggcttgctaatccagtggtcataaaag
gggaagaaaataagttatttgttgctaataaaagatgttcattcactaccaaattgaaat
aggaatcatttagcatgtggcattatgtttaaaattattattttcctcttgtatttagat
CTTTCTCTGGAATCAAAGGACTCCAGCTGAAAGTTAACCTCCAACCCAATGATAACTACT
TTTTCTATGTGAGGGCCATCAATGCATTTGGGACAAGTGAACAGAGTGAAGCTGCTCTCA
TCTCCACCAGAG
gtactttctcctttgcacacagtgagctatttccaagctatttcttcccttccacccctc
agagaagatgtcctagagggcaactttataaactcccaacctactgtcagtggtaggttt
ttgtcatgaggacccaaggttggtcaaaggtcaagatatttcttttgtttttctgcttta
EXON 10  100 bp
gccaccggcatccacgaaggccttatcatgagtgaagttttcagctgtggatctgaagac
acttcgtgggggattttgacgtcaggggaaagagtctagggtctgaaatgtggggcttag
cctagggacagcactggtccttgtggcaatgttttaatactattttctcacctgcaatag
GAACCAGATTTCTCTTGTTGAGAGAAACAGCTCATCCTGCTCTACACATTTCCTCAAGTG
GGACAGTGATCAGCTTTGGTGAGAGGAGACGGCTGACGGA
gtaagtagaagaagaaagcacaagtgggctgatggcccagcagtagggtcttagggtgtg
tcgcctcagggtggcctccgctgagcatattcatggtgcagtgaacatgtcgggatgtgg
tctcaaatatcaatgtgtgcacatccacactgttcggctgtggttccctaccgagcgata
EXON 11  174 bp
agttctgtggtgatctggttaaggttagggatacaatgaacagagtatctttagttaaat
tccagcagtttccaagggcagaatcctgcctaaactgtgtgagtttgtgaatgtttatgc
ttatgagatacaggccggcgattcctgcactgagcatactctgattgacttcacccacag
AATCCCGTCAGTGCTGGGTGAGGAGCTGCCTTCCTGTGGCCAGCATTACTGGGAAACCAC
AGTCACAGACTGCCCAGCATATCGACTCGGCATCTGCTCCAGCTCGGCTGTGCAGGCAGG
TGCCCTAGGACAAGGGGAGACCTCATGGTACATGCACTGCTCTGAGCCACAGAG
gtaagcgagcccttcccctcccctcttcatcaaaatattatgcttgggtgtccaggcagg
gctctctgagggacctgataaatagcacccacttccatgctcaacttctgagccaactaa
gaaagaaaacaagagtcaagtatatggagatgaaactctgactctgattactgaggaagc
EXON 12  856 bp
ataagctctgcattttagcatctagaagaaatctagtgaagtatttgggacagcattatt
gcaactccttattgtgaagtggagttaataactgaagaattggttattcccaagtgactt
tccttttcaaattccttgagatttccagagttttatgtttcccattcgctttcatttcag
ATACACATTTTTCTACAGTGGTATTGTGAGTGATGTTCATGTGACTGAGCGTCCAGCCAG
AGTGGGCATCCTGCTGGACTACAACAACCAGAGACTTATCTTCATCAACGCAGAGAGCGA
GCAGTTGCTCTTCATCATCAGGCACAGGTTTAATGAGGGTGTCCACCCTGCCTTTGCCCT
GGAGAAACCTGGAAAATGTACTTTGCACCTGGGGATAGAGCCCCCGGATTCTGTAAGGCA
CAAGTGATCCTTGGCTTTCAGAATTTGCAAGAACAGCGATTTGAATTTTGGGGGGGTCTG
CTGTTCATTCCTTTAGGTGCTATACATTATTCAAAAAGTCTCCCGCGCATTTGCACTAAT
GATGGCTGCATGCATAGCAATCAGCATGTGAGCAAAATCGACAAGAAAACCTTGACTTTA
CAGAGCAGTGTGTGAGTAAACAGAATGAAAACAACAACCTCCACTCTTTAGTTTATATAA
GTTTGAGTTCTTTCCTAAATTAAAAGATCTACACTTGAGTTGGGAACCGAAAGAGAAAAA
TGGACTTCCATCTGTTTTACTGGTAAAGGAAATCCTCTGATGGACAGGTCAGAGTGAAGG
AAGGTTGTGCTGGTAAGACATCTCTGACGAAGAGCCATGGATGCTTTCCACAAAATGTCA
CCTCGCTGCACTAAAGGATGATGAATCCTAATCATTAAAGGAATTGTTTCAGCTGATTTA
AATTTATAATGAACTCTTTTGTAATAATGTATACTGTAGAACATGAGTCTCTCCTCCCTA
AAATTTTAAATGTAGAAATGTGCTATATATTAGAAATTTCCATTTTGTTAAATAAATGGT
TAGAGTCTATAAAGCC
agtcgtgttatgtgaacttactccatgtaacttactggcctggcatctctggagcaggac
aaactgcagagtaaaactcattacacttcagtgcagtgcactactattgattttcctgtg
agaattttacacacacacacacacactttaaaatctaatcactctcagaccatagttata