Gene CLK4 Variant 1
DNA : 20.15 KbNT_077451
mRNA : 1792 bp NM_020666
CDS : 1446 bp NP_065717
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  161 bp
atgcctcttagcagtcatctgacataccagtgccttgggaagcattaccacctaaaaaga
ttttggagcctgtaagaccctgtgtgttgggttttgataacttaaataatattaatatat
aataatttacctatcacacatctgtaacctccacaattcccttttcatttctatcaacag
ATGCGGCATTCCAAAAGAACTCACTGTCCTGATTGGGATAGCAGAGAAAGCTGGGGACAT
GAAAGCTATCGTGGAAGTCACAAGCGGAAGAGGAGATCTCATAGTAGCACACAAGAGAAC
AGGCATTGTAAACCACATCACCAGTTTAAAGAATCTGATTG
gtaaattaactcttgaactactagcattttagctctaatagttttaaatgatttgtcatt
tgcttatatagctttcatctgtcaaattgttttataattcagtcaacaaatattcgttta
gaaaatatttgagtacttattttagataggcgctgaggctacagctgtaaataaaacaaa
EXON 2  223 bp
gtttgttaaagtaaaattatttcttaagctttatgagataaatataaatgctaattcatc
tgtttgaatttttttcttatattgagttagctgtttaagaatttctgagaaaatgttttg
tttgaaccacattattgcagaatgaagagaataatttgaaatcttttaatgtgtttgcag
TCATTATTTAGAAGCAAGGTCCTTGAATGAGCGAGATTATCGGGACCGGAGATACGTTGA
CGAATACAGGAATGACTACTGTGAAGGATATGTTCCTAGACATTATCACAGAGACATTGA
AAGCGGGTATCGAATCCACTGCAGTAAATCTTCAGTCCGCAGCAGGAGAAGCAGTCCTAA
AAGGAAGCGCAATAGACACTGTTCAAGTCATCAGTCACGTTCG
gtatgattggttttgttttcaatttgagtggagttttatttgtgtgtactcttaacgagc
tgataagtttctaattttttatatatatatatataaaatactatttggatatattataat
tgtatttatattacttaaatccttaaaggaaacctccaaattcttgtagctgatctgtat
EXON 3  91 bp
ctgtgccctgtgaatttctggggactgaatttgaaattgctcctgccaactgttcgtggc
ctggtgcttatctgaatgcctgaatatctccccgctgaatgaattgcgtattctgccctg
aattcactctgatatattgattggctggacgatcttggtgctgcccacttgccgttccag
AAGAGCCACCGAAGGAAAAGATCCAGGAGTATAGAGGATGATGAGGAGGGTCACCTGATC
TGTCAAAGTGGAGACGTTCTAAGAGCAAGAT
gtatagaatatttttcaacactttttaaactttgcagaaagaataatctttttaagaata
gtttgtcagcggggggctaaagaactcttcattgcttttttattttgctttttgtgggtt
tgtttgttcttttatatttcttcttttctgtagaatttaaatatttctattctaaagttc
EXON 4  67 bp
aagatagctctatctaattgtttttgtagcagctgaaactaaaataatttgagtgctgaa
accttagttatgctttgttagagatcatttgaaaatattccacacttaagcattcattgt
ttgaagaactagacagtttgtactcaggtacttacacctctttttccctcctcactctag
ATGAAATCGTGGACACTTTGGGTGAAGGAGCCTTTGGCAAAGTTGTAGAGTGCATTGATC
ATGGCAT
gtaagtttgttttttccttttcaaacattctgatgtttttggtggggaaagattcataat
tcagatgaaattttatttatttatttatttgagatagggcctctgttgcccaggcttgag
tgcagtggtgctatcttggctcactgcaactgccgcctcccggcttcaagtgattctcct
EXON 5  117 bp
tataaagtattttatcaaaatgttttaagaagatgttatatggaatctgctataatatgt
tctgaaagattattttaaatggcatagaggaattggtaattaagactatgctttagagca
taacatggcttcagctcactcttgtacatttatcatttttatcttaattttatttttaag
GGATGGCATGCATGTAGCAGTGAAAATCGTAAAAAATGTAGGCCGTTACCGTGAAGCAGC
TCGTTCAGAAATCCAAGTATTAGAGCACTTAAATAGTACTGATCCCAATAGTGTCTT
gtaagtataactttcacctaggagccatcatattacatgaaatattcaggtttccataaa
ctgaattattattttgctctgttttagccgatgtgtccagatgctagaatggtttgatca
tcatggtcatgtttgtattgtgtttgaactactgggacttagtacttacgatttcattaa
EXON 6  167 bp
aatcgtaaaaaatgtaggccgttaccgtgaagcagctcgttcagaaatccaagtattaga
gcacttaaatagtactgatcccaatagtgtcttgtaagtataactttcacctaggagcca
tcatattacatgaaatattcaggtttccataaactgaattattattttgctctgttttag
CCGATGTGTCCAGATGCTAGAATGGTTTGATCATCATGGTCATGTTTGTATTGTGTTTGA
ACTACTGGGACTTAGTACTTACGATTTCATTAAAGAAAACAGCTTTCTGCCATTTCAAAT
TGACCACATCAGGCAGATGGCGTATCAGATCTGCCAGTCAATAAATT
gtaagtacacttgataaatctttatttttatttatttatttatttatttattttgagacg
gagtctcgctctgtcacccaggctggagtgcagtggcgctctcgggtcccagcaagctca
gcctcccgggttcacgccattttcctgcctcagcctcccgagtagctgggactacaggcg
EXON 7  95 bp
agaaaacttgtttttattatacaagctatatatccaaatgttgtcactaaaaaaacagac
attttacaagtaaagatgaatcgtctcttgaccactatatcctttgccagtcctcctttc
cctcctagtacaaattaagtttgtaagtgaaactaataatgtgcttttgttctcttgtag
TTTTACATCATAATAAATTAACCCATACAGATCTGAAGCCTGAAAATATTTTGTTTGTGA
AGTCTGACTATGTAGTCAAATATAATTCTAAAATG
gtaagttaaagacttgttttaatttgggtggttgtctttaaaattaatttaacttgatga
tctttggatgaggaatttcacttctgagccttattatatcctgttgtttaaccaaaaaga
agtaatccttctttgcctttctcatgagcttactttgacaatcaagaagataattcatgt
EXON 8  130 bp
aggaatttcacttctgagccttattatatcctgttgtttaaccaaaaagaagtaatcctt
ctttgcctttctcatgagcttactttgacaatcaagaagataattcatgtgctggccttt
tgagtagcgctataaaatgtatctattgagtttcatgtttactcaactgtgtctctctag
AAACGTGATGAACGCACACTGAAAAACACAGATATCAAAGTTGTTGACTTTGGAAGTGCA
ACGTATGATGATGAACATCACAGTACTTTGGTGTCTACCCGGCACTACAGAGCTCCCGAG
GTCATTTTGG
gtcagtagacaccaggctttctaatattataattgaagaagagatttttgttctttacag
ctttactggtggggtggggaagtatgatcttctcagcaggattcagaaaacgttttctat
tttcataaaaaatgtgtggacattgctataaatacttttcctgagtggtaaacatgtgat
EXON 9  83 bp
tatggactatggagtgtgttgaatagcatttgctgtaaaactagaactataaaccctgaa
tttggtgtcttattctcccaaatgggttctgtaaagggagcactcatatagggaaggatt
taatgtactgtcaattaaaagtttttgcatagtaaaatgtttctatttgttttaaaatag
CTTTAGGTTGGTCTCAGCCTTGTGATGTTTGGAGCATAGGTTGCATTCTTATTGAATATT
ACCTTGGTTTCACAGTCTTTCAG
gtacgtggctagtaaattccatttaataattcataacaaattgtaaacgttaaaggtatg
ctaaagttttgacttccatattggaaaattgccatacatcattattcttgagattaaaac
ttaggcaaaatggtcattctttaaaaccacagttgaatgaaatattactatgagtgagtg
EXON 10  80 bp
taattttggttaagcagctgattaaatgaggagacagtttttctggtaaccttgcccagt
tattctttaaacagtgtaagaagtgcaaataaagaaggaaactaaaattttagattaaac
aagttaatgtgtttgtagggaaatggagagtactaaatttctttttcttacatgttttag
ACTCATGATAGTAAAGAGCACCTGGCAATGATGGAACGAATATTAGGACCCATACCACAA
CACATGATTCAGAAAACAAG
gtatgttttaagattcaagacttttgttggatatgtgcaatagcatatattcaaactaca
gaaaacccaacgttgttgtaatactgattccaaggactatagattttgactttttttttt
ttttctgtactggaggtaacttctaacttcatcttactcctttttttttttttgagatgg
EXON 11  91 bp
ggaggatatgaggtgtccgatatataattgttgctgaggtttttaaaaattgtatgcatc
tatattatataagtctatacacttagagagagctgctttccatgtctcccctcatgggtg
cagggtaaagatacgactcttgttattttactaatccagactttttttttttttctgtag
AAAACGCAAGTATTTTCACCATAACCAGCTAGATTGGGATGAACACAGTTCTGCTGGTAG
ATATGTTAGGAGACGCTGCAAACCGTTGAAG
gtaaaagaaaaaagattaaaggttaaataaaccacgtgtttgcactattaataatttttt
ttaaaacaaaaacatttctcccccaggaatttatgctttgtcatgatgaagaacatgaga
aactgtttgacctggttcgaagaatgttagaatatgatccaactcaaagaattaccttgg
EXON 12  487 bp
tagaaaacgcaagtattttcaccataaccagctagattgggatgaacacagttctgctgg
tagatatgttaggagacgctgcaaaccgttgaaggtaaaagaaaaaagattaaaggttaa
ataaaccacgtgtttgcactattaataattttttttaaaacaaaaacatttctcccccag
GAATTTATGCTTTGTCATGATGAAGAACATGAGAAACTGTTTGACCTGGTTCGAAGAATG
TTAGAATATGATCCAACTCAAAGAATTACCTTGGATGAAGCATTGCAGCATCCTTTCTTT
GACTTATTAAAAAAGAAATGAAATGGGAATCAGTGGTCTTACTATATACTTCTCTAGAAG
AGATTACTTAAGACTGTGTCAGTCAACTAAACATTCTAATATTTTTGTAAACATTAAATT
ATTTTGTACAGTTAAGTGTAAATATTGTATGTTTTGTATCAATAGCATAATTAACTTGTT
AAGCAAGTATGGTCTTGATAATGCATTAGAAAAATTAAAATTAATTTTTCTTTTTGAAAT
TACCATTTTTAAATACCTTTGAAATATCCTTTGTGTCCAGTGATAAATGTGATTGATCTT
GCCTTTTGTACATGGAGGTCACCTCTGAAGTGATTTTTTTTGAGTAAAAGGAAATCTTGA
CTACTTT
atattcttaaaggaatattctttatatacttcaaatttagaacttaactttaaaagtttt
tcttctgtaattgttgaacgggtgattattattaactctagataagcaggtactagaaac
caaaactcagaaaatgtttactgttagaattctattaaattttaagtgttgtattctttt