Gene CCNB1 Variant 1
DNA : 10.61 KbNT_006431
mRNA : 1540 bp NM_031966
CDS : 1302 bp NP_114172
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  198 bp
tccaggtggccgctgcagctgcccgagagcgcaggcgcagaggcagaccacgtgagagcc
tggccaggccttccggcctagcctcactgtggccccgcccctctcgaacgccttcgcgcg
atcgccctggaaacgcattctctgcgaccggcagccgccaatgggaagggagtgagtgcc
ACGAACAGGCCAATAAGGAGGGAGCAGTGCGGGGTTTAAATCTGAGGCTAGGCTGGCTCT
TCTCGGCGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCTGGGTGTAGGTCCTTGGCTGGT
CGGGCCTCCGGTGTTCTGCTTCTCCCCGCTGAGCTGCTGCCTGGTGAAGAGGAAGCCATG
GCGCTCCGAGTCACCAGG
gtgagccgcttcggactgcgaactaacgcggccttcttagctgctgcctgctctccctgc
ctcgcctgcgggagcctcccgagcgggagagggccgcaggagcgatttggggaggaaggt
gggaggggactcaccaagagagcgccgaggtgggcccaggcctggtgagagagtgtgggg
EXON 2  171 bp
ggtcggcggaaactgacttgtcacggccgcagagtagactctgggacccatgttttccct
cggaacccatttttagtcggctttctttctgggaacttctccttgtgccccaccttaatt
aacccttgacttactcgagccttcgtggatcagctcttaaagtggtcttgcttctttcag
AACTCGAAAATTAATGCTGAAAATAAGGCGAAGATCAACATGGCAGGCGCAAAGCGCGTT
CCTACGGCCCCTGCTGCAACCTCCAAGCCCGGACTGAGGCCAAGAACAGCTCTTGGGGAC
ATTGGTAACAAAGTCAGTGAACAACTGCAGGCCAAAATGCCTATGAAGAAG
gtaactctcttcctgacctaacttctgtaagagcccgccttccaactgtggcctttgatg
cagaaacatttcattctctctgtttcatctacaggaagcaaaaccttcagctactggaaa
agtcattgataaaaaactaccaaaacctcttgaaaaggtacctatgctggtgccagtgcc
EXON 3  171 bp
agcccggactgaggccaagaacagctcttggggacattggtaacaaagtcagtgaacaac
tgcaggccaaaatgcctatgaagaaggtaactctcttcctgacctaacttctgtaagagc
ccgccttccaactgtggcctttgatgcagaaacatttcattctctctgtttcatctacag
GAAGCAAAACCTTCAGCTACTGGAAAAGTCATTGATAAAAAACTACCAAAACCTCTTGAA
AAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAG
CCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATTTTG
gtaaacttattcttaccattgtagagtctgttgattatttcttgtcccttatttcactga
tacatgcaagagcattcaaatgaatagtaatattaataccatttattgagtgcttagcat
gaggcaagctctgcctaacattttacatgcattaactcacataatctttacacgtactct
EXON 4  183 bp
gttaatcacttcctaaaaagaaatggaataaatctgaaaagatacttttcctttaaggaa
atgaattgtatgccgattcagcagaatactagcttgagttggtaccaataacctgaactt
catgcccaaactatagtgcttacttctatttgctatttcaagatatctctttgtttcaag
GTTGATACTGCCTCTCCAAGCCCAATGGAAACATCTGGATGTGCCCCTGCAGAAGAAGAC
CTGTGTCAGGCTTTCTCTGATGTAATTCTTGCAGTAAATGATGTGGATGCAGAAGATGGA
GCTGATCCAAACCTTTGTAGTGAATATGTGAAAGATATTTATGCTTATCTGAGACAACTT
GAG
gtaagtattatcattcgttttttttctaaactgcatctaactttatgaaagtattttcca
tcaatagtttataataatacaagcaggacgtgggcagcatttcttaagagatcgcacttt
caaattctccttcatggaatacctataataaaaagtcactaaataaaccaatggagtcta
EXON 5  159 bp
atgtttgctttatttcttggtgatggtgttgtttgtggttgaccatatgaataattgaat
taagaactgatatagattataaatgccccagtgctactgtaggaactaactgatctttct
ggacataaatgtgtcacatggagtcatgtttctaagaataatcagcattttcttttgcag
GAAGAGCAAGCAGTCAGACCAAAATACCTACTGGGTCGGGAAGTCACTGGAAACATGAGA
GCCATCCTAATTGACTGGCTAGTACAGGTTCAAATGAAATTCAGGTTGTTGCAGGAGACC
ATGTACATGACTGTCTCCATTATTGATCGGTTCATGCAG
gtgagcatttcagtaagagttttcccttccaggattctagccgagtcataagaaactgat
gttttcaggccagtctgggcgcagtggctcatgcctgtaatcccagcgggcgggtggatc
acaaggttaggagatcgagaccatcctggccaacgcagtaaaaccctgtctctactaaaa
EXON 6  237 bp
agagcgagactcaaaaaaaaaagaaagaaataaactgactttttcaactaaaatctttct
tgggggatatggtgtcattaagattttgctatgggagaatgtctttctacctctccttca
tcatagctctgtgtctccttttcaaacattttattcaccctattgaaattcccattgcag
AATAATTGTGTGCCCAAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCA
AGCAAATATGAAGAAATGTACCCTCCAGAAATTGGTGACTTTGCTTTTGTGACTGACAAC
ACTTATACTAAGCACCAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAACTTT
GGTCTGGGTCGGCCTCTACCTTTGCACTTCCTTCGGAGAGCATCTAAGATTGGAGAG
gtacaggtttcttgagaaacctctccgtatgggtacattagggggaacactgctgctgac
caagcacgttgaattcaactgacctgtattatacctaactacatggggaagggataaagt
tgttctttatttctagtcaggctgcatgttaatattaggactttccatgggcatttgaga
EXON 7  141 bp
tggggaagggataaagttgttctttatttctagtcaggctgcatgttaatattaggactt
tccatgggcatttgagagtttgtagacaaacatttgtagttaaagatacatatgggcatg
caggttagtgccaaaggaaaattttctgaaagaaactcagtaacatgggttttgtttcag
GTTGATGTCGAGCAACATACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTAT
GACATGGTGCACTTTCCTCCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAA
ATTCTGGATAATGGTGAATGG
gtaagctgtgtcccacagaactcctaagcttttaaattttaaagagtgactaaatacaga
acttttgttattaaaaggcaattcaagtggttcataaatatgggatctactgaaggaata
gttaaaaaagatgtcttagaatgtttccacatctttttgtttttgagacaaggtctcgct
EXON 8  111 bp
tttgagcagaggaagcatgagagcacctaggaaaggagtctttagctttgtcttaaattt
cagttatattaattatacagtacccatctcttttccactcctgaataacatctaacatct
agaaactttatgaaaatcattattgatttgagcatttttaacattaacttgttgccttag
ACACCAACTCTACAACATTACCTGTCATATACTGAAGAATCTCTTCTTCCAGTTATGCAG
CACCTGGCTAAGAATGTAGTCATGGTAAATCAAGGACTTACAAAGCACATG
gtgagtcaatatagtggcattgtaagatgctgaaaagtgtaataattcaaacttaatgcc
tgcaaatgcctggtttatttttaatgagttaatgttttaaatgaatacctgtatcattgc
atcttgtgattttttttcttttgcctctttaattgctatctttttgtcttccagactgtc
EXON 9  169 bp
cacatggtgagtcaatatagtggcattgtaagatgctgaaaagtgtaataattcaaactt
aatgcctgcaaatgcctggtttatttttaatgagttaatgttttaaatgaatacctgtat
cattgcatcttgtgattttttttcttttgcctctttaattgctatctttttgtcttccag
ACTGTCAAGAACAAGTATGCCACATCGAAGCATGCTAAGATCAGCACTCTACCACAGCTG
AATTCTGCACTAGTTCAAGATTTAGCCAAGGCTGTGGCAAAGGTGTAACTTGTAAACTTG
AGTTGGAGTACTATATTTACAAATAAAATTGGCACCATGTGCCATCTGT
acatattactgttgcatttacttttaataaagcttgtggccccttttacttttttatagc
ttaactaatttgaatgtggttacttcctactgtagggtagcggaaaagttgtcttaaaag
gtatggtggggatatttttaaaaactccttttggtttacctggggatccaattgatgtat