Gene APC Variant 1
DNA : 91.07 KbNT_034772
mRNA : 10363 bp NM_000038
CDS : 8532 bp NP_000029
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  155 bp
cactgtttcatcctcttagatgctgctacttgaacaatattgttttgagaccaaaaacta
gcatattaacacaattcttcttaaacgtcttaagagttttgtttcctttacccctttctt
taaaaacaagcagccactaaattttttagtagtgaatttcaaaatcctttttaaccttat
AGGTCCAAGGGTAGCCAAGGATGGCTGCAGCTTCATATGATCAGTTGTTAAAGCAAGTTG
AGGCACTGAAGATGGAGAACTCAAATCTTCGACAAGAGCTAGAAGATAATTCCAATCATC
TTACAAAACTGGAAACTGAGGCATCTAATATGAAG
gtatcaagactgtgacttttaattgtagtttatccatttttattcagtattccctcttgt
aaacttgaggtaagacactttacttaaaagtgtattttaaattaagcaataatatgtaaa
ctctttcttgcaaaagttagcatttatatttttaaataagatatattgaattcattcagt
EXON 2  85 bp
actattattatttggccatgatttatttattaataatgaataataggtaatatatataag
gtgcgtgctttgagagtgatctgaatttttttctcagcatacttaaatgtcaagaaatac
agaatcatgtcttgaagttatttagaatttcatgttaatatattgtgttctttttaacag
GAAGTACTTAAACAACTACAAGGAAGTATTGAAGATGAAGCTATGGCTTCTTCTGGACAG
ATTGATTTATTAGAGCGTCTTAAAG
gtagattttaaaaaggtgttttaaaataattttttaagctcaaattgtcatctttaggtg
tgtagatccaagtacagcttctctcgatttgggtgttggtatcagttttcttggtatgtt
agccttaccctcaggatgtaattgttaaagtacaaataaataaaaaatgtatttgtgtgt
EXON 3  202 bp
tttttaccctgacccaagtggacttttcagggaaagtcctaaataatttttgttttcagt
catgtatatttgtggttaaaatgtaaacctaatatttcactttaaaataatataacatta
agaatattttagactgcttaaagcaattgttgtataaaaacttgtttctattttatttag
AGCTTAACTTAGATAGCAGTAATTTCCCTGGAGTAAAACTGCGGTCAAAAATGTCCCTCC
GTTCTTATGGAAGCCGGGAAGGATCTGTATCAAGCCGTTCTGGAGAGTGCAGTCCTGTTC
CTATGGGTTCATTTCCAAGAAGAGGGTTTGTAAATGGAAGCAGAGAAAGTACTGGATATT
TAGAAGAACTTGAGAAAGAGAG
gtaacttttcttcatatagtaaacattgccttgtgtactccagtttattgttattttgta
atataatatttaaattgtgaatttatagtaggtgatagctaacacttagagcattttgca
tttttaaactcaaagatagcatgttattgattgcacttacattaaatctaaaaatataaa
EXON 4  109 bp
aatgactgtaatattctaagtcctacctttaaaaattgaaatcaatgtaaattttttgag
taattcattattagcactttaggtagagaagtttgcaataacaactgatgtaagtattgc
tcttctgcagtctttattagcattgtttaaacgtacctttttttaaaaaaaaaaaaatag
GTCATTGCTTCTTGCTGATCTTGACAAAGAAGAAAAGGAAAAAGACTGGTATTACGCTCA
ACTTCAGAATCTCACTAAAAGAATAGATAGTCTTCCTTTAACTGAAAAT
gtaagtaacttggcagtacaacttatttgaaactttaataacttgatattttaaagtacc
taggtaatccattaaaattcaggataactgaatttatagttatttgtaaattgcaatatg
ttttacccaactttaggcctgaatatataatagttaatgaatttttgttggtaaagatga
EXON 5  114 bp
ttgagtctgacacctataatcaaatttaaacactccttggagtaaaaaataattttctca
tgcaccatgactgacgtatttgcttattcattttctttattggttcttatatgctttttt
gcttttactgattaacgtaaatacaagatattgatacttttttattatttgtggttttag
TTTTCCTTACAAACAGATATGACCAGAAGGCAATTGGAATATGAAGCAAGGCAAATCAGA
GTTGCGATGGAAGAACAACTAGGTACCTGCCAGGATATGGAAAAACGAGCACAG
gtaagttacttgtttctaagtgataaaacagcgaagagctattaggaataaaatgaatta
cagctctgttaatattgattaaattttattaaagacataaggctgtgtttattttggctc
tatttcaaaataagatttatcatggctgctgagcaacataatcaatattcacatagttgt
EXON 6  84 bp
aaagaaaaattgaactgaccccaatttgttattaaagggtgaatatatttatatgtctag
ctttttaaatgagaatgatttgacataaccctgagcttttaagtggtagccatagtatga
ttatttctattaatattattaataaaaacataactaattaggtttcttgttttattttag
CGAAGAATAGCCAGAATTCAGCAAATCGAAAAGGACATACTTCGTATACGACAGCTTTTA
CAGTCCCAAGCAACAGAAGCAGAG
gttagtaaattgcctttcttgtttgtgggtataaaaataggtagttattctgagaaaaga
aaacatgtataatttaatgtgacaccattgaaatatagatgttctttcagagaatttaaa
taccgtaatttttttcgtgaaattaaattatcaaagatttggactattttgattttatct
EXON 7  105 bp
accgagatagtcgaccgccaatcgtactggaggttatgaagtgtaatacacagttccatg
cctttatcagtctgtataattgatgcattcagagctttaaagcaaaaaaagaaaaaaagc
cttgggctaagaaagcctacaccatttttgcatgtactgatgttaactccatcttaacag
AGGTCATCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAGAATGAAGGT
CAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAG
gtaaataaattattttatcatattttttaaaattatttaaatatcagaaaagtatgaagc
aagatggttctaagaatgatctataaatcttacctattttcttagtcctgaatgcatatt
tccagaagcattcagtaccaatgtgctgtcatttctctttattatatcagcaataatgct
EXON 8  99 bp
ctaaaacatacttagtaagcgtataggtaaaaaatattttgaacagttataatggtcata
cttttatgatgtatttaattgtttatcatacagacacttcatttggagtaccttaacatg
atgttatctgtatttacctatagtctaaattataccatctataatgtgcttaatttttag
GGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACAC
TCTGCACCTCGAAGGCTGACAAGTCATCTGGGAACCAAG
gtaacagaagattacaaaccctggtcactaatgccatgactactttgctaagacattctt
ggccaggtgcagtggctcacacctgtaatcccagcattttgggaggccaaggcaggtgga
tcacttgaggccaggagttcaagaccagcctgggcaacgtggcaaaaccccatctctact
EXON 9  379 bp
ttgaaataacactgattacttcatcctggaaaggttttccggttttttgttttttttttg
gcggggggggttgttttgtttttttagagttatagtaaatatcccattcatcacttaatt
ggtttttggcttttggatattaaagtcgtaattttgtttctaaactcatttggcccacag
GTGGAAATGGTGTATTCATTGTTGTCAATGCTTGGTACTCATGATAAGGATGATATGTCG
CGAACTTTGCTAGCTATGTCTAGCTCCCAAGACAGCTGTATATCCATGCGACAGTCTGGA
TGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGA
AATTCCCGGGGCAGTAAAGAGGCTCGGGCCAGGGCCAGTGCAGCACTCCACAACATCATT
CACTCACAGCCTGATGACAAGAGAGGCAGGCGTGAAATCCGAGTCCTTCATCTTTTGGAA
CAGATACGCGCTTACTGTGAAACCTGTTGGGAGTGGCAGGAAGCTCATGAACCAGGCATG
GACCAGGACAAAAATCCAA
gtatgttctctatagtgtacatcgtagtgcatgtttcaaagcaaatgtgaaatttttaaa
cagaaaacatgtttagttaatatgctgtctttatgactaagaggagaaaattcatatcag
ccatttgtgctactcatatttaaaagattaagtctgtatttccctagaaaaatttagcaa
EXON 10  96 bp
tcctattttttgttccacatttgtagtatttattcatcctttcagcaaatatttgttgat
ccactaaaattccgtgaattagggttatattagtgatccctgcatatttttaaagtacaa
taaacatcattgctcttcaaataacaaagcattatggtttatgttgattttatttttcag
TGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCAT
TTGATGAAGAGCATAGACATGCAATGAATGAACTAG
gtaagacaaaaatgttttttaatgacatagacaattactggtggatttttaaatcatggt
agaaattcagtatagtaaataaagatttttaatcattgatgaattaggatataaggccac
caacttctgttatcagctgcttcctctgtgtagcaaaaaattgtaccctggtttccagca
EXON 11  140 bp
taaatatattatacagaagttctttataacagtttttgtagcttataattctaaaggcaa
atttaaaccatatattctcattgattgagtttttttttcctagtatttaagttaccaact
tggtaccagtttgttttattttagatgattgtctttttcctcttgccctttttaaattag
GGGGACTACAGGCCATTGCAGAATTATTGCAAGTGGACTGTGAAATGTATGGGCTTACTA
ATGACCACTACAGTATTACACTAAGACGATATGCTGGAATGGCTTTGACAAACTTGACTT
TTGGAGATGTAGCCAACAAG
gtatgtttttataacatgtatttcttaagatagctcaggtatgagttaatttactttcat
acaaatacattttactgattttcttttttttcactctcctcattaaacaatgactgataa
aaacctgtgcttcacattcgcttatctttactcatttgtttgtcttatgcctaaacaaag
EXON 12  78 bp
agaattaggagaatatttgtcttttatttaggtaatcttattctagattttttatgagtg
aagtatcagttatgattaaaacaaaataatgaaaactgaattagacatttagtagccaaa
aataaagcttggcttcaagttgtctttttaatgatcctctattctgtatttaatttacag
GCTACGCTATGCTCTATGAAAGGCTGCATGAGAGCACTTGTGGCCCAACTAAAATCTGAA
AGTGAAGACTTACAGCAG
gtactatttagaatttcacctgtttttcttttttctctttttctttgaggcagggtctca
ctctgtcacccaggcttagagggcagttgtgcaatctcagctcactgcaacctctgcctc
cagggttcaagcaatcctcccacttcagcctctcgaggctgggcctacaggtgcacacca
EXON 13  117 bp
tggtctcaggagatcctcctgcctcagcctcccaaagtgataggattacaggcgtgagtc
accacggctagccagaatttctttcttaatagatttctattcttactgctagcattaaaa
acaaaaaagcaactagtatgattttatgtataaattaatctaaaattgattaatttgcag
GTTATTGCGAGTGTTTTGAGGAATTTGTCTTGGCGAGCAGATGTAAATAGTAAAAAGACG
TTGCGAGAAGTTGGAAGTGTGAAAGCATTGATGGAATGTGCTTTAGAAGTTAAAAAG
gtacctttgaaaacatttagtactataatatgaatttcatgtttggcttttttttgctgc
cttcttttagccatgagatttcctaatttcttacctgtgtattattcagtactataatat
gaatttcatgtttagctttttttgctgccttcttttagccatgagattccctaatttctt
EXON 14  215 bp
tataaatactatttggtattttatgaacatttttctaaatggaaagttcttaatttacca
gtgagggacgggcaataggatagattaaaaaatagcttttattcaatatcagtaacatag
aagttaatgagagacaaattccaactctaattagatgacccatattctgtttcttactag
GAATCAACCCTCAAAAGCGTATTGAGTGCCTTATGGAATTTGTCAGCACATTGCACTGAG
AATAAAGCTGATATATGTGCTGTAGATGGTGCACTTGCATTTTTGGTTGGCACTCTTACT
TACCGGAGCCAGACAAACACTTTAGCCATTATTGAAAGTGGAGGTGGGATATTACGGAAT
GTGTCCAGCTTGATAGCTACAAATGAGGACCACAG
gtatatatagagttttatattacttttaaagtacagaattcatactctcaaaaagaccta
attgtaagcaatgttttatataatcatgaaagttttaagccaaaatatatttattactgt
gaaaagataactactaactcttagtttaactcattagtgtacttaatgtaataacagttt
EXON 15  8385 bp
gattagtactttaaaacattaaacattacatgaaattagaacaaaaggagatgtggaata
cttggaatttataggataattggtacaatcatattatgccttttgtcttctatcctttta
tttgttgttactgcatacacattgtgaccttaattttgtgatctcttgattttatttcag
GCAAATCCTAAGAGAGAACAACTGTCTACAAACTTTATTACAACACTTAAAATCTCATAG
TTTGACAATAGTCAGTAATGCATGTGGAACTTTGTGGAATCTCTCAGCAAGAAATCCTAA
AGACCAGGAAGCATTATGGGACATGGGGGCAGTTAGCATGCTCAAGAACCTCATTCATTC
AAAGCACAAAATGATTGCTATGGGAAGTGCTGCAGCTTTAAGGAATCTCATGGCAAATAG
GCCTGCGAAGTACAAGGATGCCAATATTATGTCTCCTGGCTCAAGCTTGCCATCTCTTCA
TGTTAGGAAACAAAAAGCCCTAGAAGCAGAATTAGATGCTCAGCACTTATCAGAAACTTT
TGACAATATAGACAATTTAAGTCCCAAGGCATCTCATCGTAGTAAGCAGAGACACAAGCA
AAGTCTCTATGGTGATTATGTTTTTGACACCAATCGACATGATGATAATAGGTCAGACAA
TTTTAATACTGGCAACATGACTGTCCTTTCACCATATTTGAATACTACAGTGTTACCCAG
CTCCTCTTCATCAAGAGGAAGCTTAGATAGTTCTCGTTCTGAAAAAGATAGAAGTTTGGA
GAGAGAACGCGGAATTGGTCTAGGCAACTACCATCCAGCAACAGAAAATCCAGGAACTTC
TTCAAAGCGAGGTTTGCAGATCTCCACCACTGCAGCCCAGATTGCCAAAGTCATGGAAGA
AGTGTCAGCCATTCATACCTCTCAGGAAGACAGAAGTTCTGGGTCTACCACTGAATTACA
TTGTGTGACAGATGAGAGAAATGCACTTAGAAGAAGCTCTGCTGCCCATACACATTCAAA
CACTTACAATTTCACTAAGTCGGAAAATTCAAATAGGACATGTTCTATGCCTTATGCCAA
ATTAGAATACAAGAGATCTTCAAATGATAGTTTAAATAGTGTCAGTAGTAGTGATGGTTA
TGGTAAAAGAGGTCAAATGAAACCCTCGATTGAATCCTATTCTGAAGATGATGAAAGTAA
GTTTTGCAGTTATGGTCAATACCCAGCCGACCTAGCCCATAAAATACATAGTGCAAATCA
TATGGATGATAATGATGGAGAACTAGATACACCAATAAATTATAGTCTTAAATATTCAGA
TGAGCAGTTGAACTCTGGAAGGCAAAGTCCTTCACAGAATGAAAGATGGGCAAGACCCAA
ACACATAATAGAAGATGAAATAAAACAAAGTGAGCAAAGACAATCAAGGAATCAAAGTAC
AACTTATCCTGTTTATACTGAGAGCACTGATGATAAACACCTCAAGTTCCAACCACATTT
TGGACAGCAGGAATGTGTTTCTCCATACAGGTCACGGGGAGCCAATGGTTCAGAAACAAA
TCGAGTGGGTTCTAATCATGGAATTAATCAAAATGTAAGCCAGTCTTTGTGTCAAGAAGA
TGACTATGAAGATGATAAGCCTACCAATTATAGTGAACGTTACTCTGAAGAAGAACAGCA
TGAAGAAGAAGAGAGACCAACAAATTATAGCATAAAATATAATGAAGAGAAACGTCATGT
GGATCAGCCTATTGATTATAGTTTAAAATATGCCACAGATATTCCTTCATCACAGAAACA
GTCATTTTCATTCTCAAAGAGTTCATCTGGACAAAGCAGTAAAACCGAACATATGTCTTC
AAGCAGTGAGAATACGTCCACACCTTCATCTAATGCCAAGAGGCAGAATCAGCTCCATCC
AAGTTCTGCACAGAGTAGAAGTGGTCAGCCTCAAAAGGCTGCCACTTGCAAAGTTTCTTC
TATTAACCAAGAAACAATACAGACTTATTGTGTAGAAGATACTCCAATATGTTTTTCAAG
ATGTAGTTCATTATCATCTTTGTCATCAGCTGAAGATGAAATAGGATGTAATCAGACGAC
ACAGGAAGCAGATTCTGCTAATACCCTGCAAATAGCAGAAATAAAAGAAAAGATTGGAAC
TAGGTCAGCTGAAGATCCTGTGAGCGAAGTTCCAGCAGTGTCACAGCACCCTAGAACCAA
ATCCAGCAGACTGCAGGGTTCTAGTTTATCTTCAGAATCAGCCAGGCACAAAGCTGTTGA
ATTTTCTTCAGGAGCGAAATCTCCCTCCAAAAGTGGTGCTCAGACACCCAAAAGTCCACC
TGAACACTATGTTCAGGAGACCCCACTCATGTTTAGCAGATGTACTTCTGTCAGTTCACT
TGATAGTTTTGAGAGTCGTTCGATTGCCAGCTCCGTTCAGAGTGAACCATGCAGTGGAAT
GGTAAGTGGCATTATAAGCCCCAGTGATCTTCCAGATAGCCCTGGACAAACCATGCCACC
AAGCAGAAGTAAAACACCTCCACCACCTCCTCAAACAGCTCAAACCAAGCGAGAAGTACC
TAAAAATAAAGCACCTACTGCTGAAAAGAGAGAGAGTGGACCTAAGCAAGCTGCAGTAAA
TGCTGCAGTTCAGAGGGTCCAGGTTCTTCCAGATGCTGATACTTTATTACATTTTGCCAC
GGAAAGTACTCCAGATGGATTTTCTTGTTCATCCAGCCTGAGTGCTCTGAGCCTCGATGA
GCCATTTATACAGAAAGATGTGGAATTAAGAATAATGCCTCCAGTTCAGGAAAATGACAA
TGGGAATGAAACAGAATCAGAGCAGCCTAAAGAATCAAATGAAAACCAAGAGAAAGAGGC
AGAAAAAACTATTGATTCTGAAAAGGACCTATTAGATGATTCAGATGATGATGATATTGA
AATACTAGAAGAATGTATTATTTCTGCCATGCCAACAAAGTCATCACGTAAAGCAAAAAA
GCCAGCCCAGACTGCTTCAAAATTACCTCCACCTGTGGCAAGGAAACCAAGTCAGCTGCC
TGTGTACAAACTTCTACCATCACAAAACAGGTTGCAACCCCAAAAGCATGTTAGTTTTAC
ACCGGGGGATGATATGCCACGGGTGTATTGTGTTGAAGGGACACCTATAAACTTTTCCAC
AGCTACATCTCTAAGTGATCTAACAATCGAATCCCCTCCAAATGAGTTAGCTGCTGGAGA
AGGAGTTAGAGGAGGGGCACAGTCAGGTGAATTTGAAAAACGAGATACCATTCCTACAGA
AGGCAGAAGTACAGATGAGGCTCAAGGAGGAAAAACCTCATCTGTAACCATACCTGAATT
GGATGACAATAAAGCAGAGGAAGGTGATATTCTTGCAGAATGCATTAATTCTGCTATGCC
CAAAGGGAAAAGTCACAAGCCTTTCCGTGTGAAAAAGATAATGGACCAGGTCCAGCAAGC
ATCTGCGTCTTCTTCTGCACCCAACAAAAATCAGTTAGATGGTAAGAAAAAGAAACCAAC
TTCACCAGTAAAACCTATACCACAAAATACTGAATATAGGACACGTGTAAGAAAAAATGC
AGACTCAAAAAATAATTTAAATGCTGAGAGAGTTTTCTCAGACAACAAAGATTCAAAGAA
ACAGAATTTGAAAAATAATTCCAAGGTCTTCAATGATAAGCTCCCAAATAATGAAGATAG
AGTCAGAGGAAGTTTTGCTTTTGATTCACCTCATCATTACACGCCTATTGAAGGAACTCC
TTACTGTTTTTCACGAAATGATTCTTTGAGTTCTCTAGATTTTGATGATGATGATGTTGA
CCTTTCCAGGGAAAAGGCTGAATTAAGAAAGGCAAAAGAAAATAAGGAATCAGAGGCTAA
AGTTACCAGCCACACAGAACTAACCTCCAACCAACAATCAGCTAATAAGACACAAGCTAT
TGCAAAGCAGCCAATAAATCGAGGTCAGCCTAAACCCATACTTCAGAAACAATCCACTTT
TCCCCAGTCATCCAAAGACATACCAGACAGAGGGGCAGCAACTGATGAAAAGTTACAGAA
TTTTGCTATTGAAAATACTCCGGTTTGCTTTTCTCATAATTCCTCTCTGAGTTCTCTCAG
TGACATTGACCAAGAAAACAACAATAAAGAAAATGAACCTATCAAAGAGACTGAGCCCCC
TGACTCACAGGGAGAACCAAGTAAACCTCAAGCATCAGGCTATGCTCCTAAATCATTTCA
TGTTGAAGATACCCCAGTTTGTTTCTCAAGAAACAGTTCTCTCAGTTCTCTTAGTATTGA
CTCTGAAGATGACCTGTTGCAGGAATGTATAAGCTCCGCAATGCCAAAAAAGAAAAAGCC
TTCAAGACTCAAGGGTGATAATGAAAAACATAGTCCCAGAAATATGGGTGGCATATTAGG
TGAAGATCTGACACTTGATTTGAAAGATATACAGAGACCAGATTCAGAACATGGTCTATC
CCCTGATTCAGAAAATTTTGATTGGAAAGCTATTCAGGAAGGTGCAAATTCCATAGTAAG
TAGTTTACATCAAGCTGCTGCTGCTGCATGTTTATCTAGACAAGCTTCGTCTGATTCAGA
TTCCATCCTTTCCCTGAAATCAGGAATCTCTCTGGGATCACCATTTCATCTTACACCTGA
TCAAGAAGAAAAACCCTTTACAAGTAATAAAGGCCCACGAATTCTAAAACCAGGGGAGAA
AAGTACATTGGAAACTAAAAAGATAGAATCTGAAAGTAAAGGAATCAAAGGAGGAAAAAA
AGTTTATAAAAGTTTGATTACTGGAAAAGTTCGATCTAATTCAGAAATTTCAGGCCAAAT
GAAACAGCCCCTTCAAGCAAACATGCCTTCAATCTCTCGAGGCAGGACAATGATTCATAT
TCCAGGAGTTCGAAATAGCTCCTCAAGTACAAGTCCTGTTTCTAAAAAAGGCCCACCCCT
TAAGACTCCAGCCTCCAAAAGCCCTAGTGAAGGTCAAACAGCCACCACTTCTCCTAGAGG
AGCCAAGCCATCTGTGAAATCAGAATTAAGCCCTGTTGCCAGGCAGACATCCCAAATAGG
TGGGTCAAGTAAAGCACCTTCTAGATCAGGATCTAGAGATTCGACCCCTTCAAGACCTGC
CCAGCAACCATTAAGTAGACCTATACAGTCTCCTGGCCGAAACTCAATTTCCCCTGGTAG
AAATGGAATAAGTCCTCCTAACAAATTATCTCAACTTCCAAGGACATCATCCCCTAGTAC
TGCTTCAACTAAGTCCTCAGGTTCTGGAAAAATGTCATATACATCTCCAGGTAGACAGAT
GAGCCAACAGAACCTTACCAAACAAACAGGTTTATCCAAGAATGCCAGTAGTATTCCAAG
AAGTGAGTCTGCCTCCAAAGGACTAAATCAGATGAATAATGGTAATGGAGCCAATAAAAA
GGTAGAACTTTCTAGAATGTCTTCAACTAAATCAAGTGGAAGTGAATCTGATAGATCAGA
AAGACCTGTATTAGTACGCCAGTCAACTTTCATCAAAGAAGCTCCAAGCCCAACCTTAAG
AAGAAAATTGGAGGAATCTGCTTCATTTGAATCTCTTTCTCCATCATCTAGACCAGCTTC
TCCCACTAGGTCCCAGGCACAAACTCCAGTTTTAAGTCCTTCCCTTCCTGATATGTCTCT
ATCCACACATTCGTCTGTTCAGGCTGGTGGATGGCGAAAACTCCCACCTAATCTCAGTCC
CACTATAGAGTATAATGATGGAAGACCAGCAAAGCGCCATGATATTGCACGGTCTCATTC
TGAAAGTCCTTCTAGACTTCCAATCAATAGGTCAGGAACCTGGAAACGTGAGCACAGCAA
ACATTCATCATCCCTTCCTCGAGTAAGCACTTGGAGAAGAACTGGAAGTTCATCTTCAAT
TCTTTCTGCTTCATCAGAATCCAGTGAAAAAGCAAAAAGTGAGGATGAAAAACATGTGAA
CTCTATTTCAGGAACCAAACAAAGTAAAGAAAACCAAGTATCCGCAAAAGGAACATGGAG
AAAAATAAAAGAAAATGAATTTTCTCCCACAAATAGTACTTCTCAGACCGTTTCCTCAGG
TGCTACAAATGGTGCTGAATCAAAGACTCTAATTTATCAAATGGCACCTGCTGTTTCTAA
AACAGAGGATGTTTGGGTGAGAATTGAGGACTGTCCCATTAACAATCCTAGATCTGGAAG
ATCTCCCACAGGTAATACTCCCCCGGTGATTGACAGTGTTTCAGAAAAGGCAAATCCAAA
CATTAAAGATTCAAAAGATAATCAGGCAAAACAAAATGTGGGTAATGGCAGTGTTCCCAT
GCGTACCGTGGGTTTGGAAAATCGCCTGAACTCCTTTATTCAGGTGGATGCCCCTGACCA
AAAAGGAACTGAGATAAAACCAGGACAAAATAATCCTGTCCCTGTATCAGAGACTAATGA
AAGTTCTATAGTGGAACGTACCCCATTCAGTTCTAGCAGCTCAAGCAAACACAGTTCACC
TAGTGGGACTGTTGCTGCCAGAGTGACTCCTTTTAATTACAACCCAAGCCCTAGGAAAAG
CAGCGCAGATAGCACTTCAGCTCGGCCATCTCAGATCCCAACTCCAGTGAATAACAACAC
AAAGAAGCGAGATTCCAAAACTGACAGCACAGAATCCAGTGGAACCCAAAGTCCTAAGCG
CCATTCTGGGTCTTACCTTGTGACATCTGTTTAAAAGAGAGGAAGAATGAAACTAAGAAA
ATTCTATGTTAATTACAACTGCTATATAGACATTTTGTTTCAAATGAAACTTTAAAAGAC
TGAAAAATTTTGTAAATAGGTTTGATTCTTGTTAGAGGGTTTTTGTTCTGGAAGCCATAT
TTGATAGTATACTTTGTCTTCACTGGTCTTATTTTGGGAGGCACTCTTGATGGTTAGGAA
AAAAATAGTAAAGCCAAGTATGTTTGTACAGTATGTTTTACATGTATTTAAAGTAGCATC
CCATCCCAACTTCCTTTAATTATTGCTTGTCTTAAAATAATGAACACTACAGATAGAAAA
TATGATATATTGCTGTTATCAATCATTTCTAGATTATAAACTGACTAAACTTACATCAGG
GAAAAATTGGTATTTATGCAAAAAAAAATGTTTTTGTCCTTGTGAGTCCATCTAACATCA
TAATTAATCATGTGGCTGTGAAATTCACAGTAATATGGTTCCCGATGAACAAGTTTACCC
AGCCTGCTTTGCTTTACTGCATGAATGAAACTGATGGTTCAATTTCAGAAGTAATGATTA
ACAGTTATGTGGTCACATGATGTGCATAGAGATAGCTACAGTGTAATAATTTACACTATT
TTGTGCTCCAAACAAAACAAAAATCTGTGTAACTGTAAAACATTGAATGAAACTATTTTA
CCTGAACTAGATTTTATCTGAAAGTAGGTAGAATTTTTGCTATGCTGTAATTTGTTGTAT
ATTCTGGTATTTGAGGTGAGATGGCTGCTCTTTTATTAATGAGACATGAATTGTGTCTCA
ACAGAAACTAAATGAACATTTCAGAATAAATTATTGCTGTATGTAAACTGTTACTGAAAT
TGGTATTTGTTTGAAGGGTCTTGTTTCACATTTGTATTAATAATTGTTTAAAATGCCTCT
TTTAAAAGCTTATATAAATTTTTTTCTTCAGCTTCTATGCATTAAGAGTAAAATTCCTCT
TACTGTAATAAAAACAATTGAAGAAGACTGTTGCCACTTAACCATTCCATGCGTTGGCAC
TTATCTATTCCTGAAATTTCTTTTATGTGATTAGCTCATCTTGATTTTTAATATTTTTCC
ACTTAAACTTTTTTTTCTTACTCCACTGGAGCTCAGTAAAAGTAAATTCATGTAATAGCA
ATGCAAGCAGCCTAGCACAGACTAAGCATTGAGCATAATAGGCCCACATAATTTCCTCTT
TCTTAATATTATAGAATTCTGTACTTGAAATTGATTCTTAGACATTGCAGTCTCTTCGAG
GCTTTACAGTGTAAACTGTCTTGCCCCTTCATCTTCTTGTTGCAACTGGGTCTGACATGA
ACACTTTTTATCACCCTGTATGTTAGGGCAAGATCTCAGCAGTGAAGTATAATCAGCACT
TTGCCATGCTCAGAAAATTCAAATCACATGGAACTTTAGAGGTAGATTTAATACGATTAA
GATATTCAGAAGTATATTTTAGAATCCCTGCCTGTTAAGGAAACTTTATTTGTGGTAGGT
ACAGTTCTGGGGTACATGTTAAGTGTCCCCTTATACAGTGGAGGGAAGTCTTCCTTCCTG
AAGGAAAATAAACTGACACTTATTAACTAAGATAATTTACTTAATATATCTTCCCTGATT
TGTTTTAAAAGATCAGAGGGTGACTGATGATACATGCATACATATTTGTTGAATAAATGA
AAATTTATTTTTAGTGATAAGATTCATACACTCTGTATTTGGGGAGGGAAAACCTTTTTA
AGCATGGTGGGGCACTCAGATAGGAGTGAATACACCTACCTGGTG
ccttgaaaatcacatcaagtagttaattatctaccccttacctgtgtttataacttccag
gtaatgagaatgattttttttaaagctaaaatgccagtaaataaaagtgctatgacttga
gctaagatatttgactccaatgcctgtactgtgtctactgcaccactttgtaaacacttc