--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (45020 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (21 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1276       1383   0    Initial    108    83        Good
tcgccttgaggggcggggccggccactcccggagaggggactacgtttcccggcgcgccg
cgcggccggagcgaaagaggagccggaagtgtggcgcgcgaggtctaagggcgcgaggga
agtggcgggcggggactaaggcggggcgtgcaggtagccggccggccgggggtcgcgggt
ATGGCCGAGGCCAGGAAGCGGCGGGAGCTACTTCCCCTGATCTACCACCATCTGCTGCGG
GCTGGCTATGTGCGTGCGGCGCGGGAAGTGAAGGAGCAGAGCGGCCAG
gtaagcgttcgtgggccgtgtgcgagggccgcgtgcaagatgtggagatcagcggcccgc
ggcccgcgccccgtccccaggcgacccggcaggcgcccggagccgggtcccgcagtgctc
gacggcgcggccaggggtaccggaggagccgcaatctctgccttcccactgcgacttcag

Exon  2 +       7642       7833   2   Internal    192   100   Excellent
tttatgaagtgagtgaaaatgcagaatacaaaattgtgcctatactgtgttttcaccact
gtttagattctatgcacattgcctttaagagctggaaggatgcgggaaggtctgtctagt
caattcttgtggagttgttctgtcacccagttggtatagacagtcacccttgtcctgcag
AACCTCAGAGCTTGGTCGGAAGCGGAAGGCAGAGGAAGATGCGGCACTGCAAGCTAAGAA
AACCCGTGTGTCAGACCCCATCAGCACCTCGGAGAGCTCGGAAGAGGAGGAAGAAGCAGA
AGCCGAAACCGCCAAAGCCAGTAAGAGCCTTGCAGCTTTGGGAACAGGCTATGGAATATT
GATTGTTCTAGG
gtagagtctacctccagcttcttctcttatcactagaagacctaaaagaccctggggagg
agattgggagggcaccacatatctttggcagtatttgagcccttcctccgtgccaggcat
tatatctccatgctctgggggtgcaaggccgaaccaaaacaaccagatgggcccttccag

Exon  3 +       7950       8062   2   Internal    113    77        Good
ccgccaaagccagtaagagccttgcagctttgggaacaggctatggaatattgattgttc
tagggtagagtctacctccagcttcttctcttatcactagaagacctaaaagaccctggg
gaggagattgggagggcaccacatatctttggcagtatttgagcccttcctccgtgccag
GCATTATATCTCCATGCTCTGGGGGTGCAAGGCCGAACCAAAACAACCAGATGGGCCCTT
CCAGTCTCATTTGGTGTATGGGGCCCAGGAGCTGCCCTATTACAGGCTCCCAG
gtgattcttattagctggaaagaagacacacgttcagaagtactgctggagggatttcag
aaagcagctagcggacacattttctgtgtgacctgtgggatgctttaggaattgctgatc
ttcatgttcatttagaattgtacccattagcactggaacgctgtactgggcactggtttt

Exon  4 +      12249      12431   1   Internal    183   100   Excellent
ggtgagaggaggtgctgtttttaacctcactttaaagattgggaaacagattgaaggggt
agtttacccaaactcacacagctaagaagtggtaagattgggttcagatgcaagtggcct
gtgctcttagttcaccatgccataccagatgtgtctgtcactcttgttctctgtaggcag
AGACAGAGAAAGCTGGCAAGACTGGGAATTCCATGCCACACCCTGCCACTGGGAAGACGG
TGGCCAACCTTCTTTCTGGGAAGTCTCCCAGGAAGTCAGCAGAGCCCTCAGCAAATACTA
CGTTGGTCTCAGAAACTGAGGAGGAGGGCAGCGTCCCGGCCTTTGGAGCTGCTGCCAAGC
CTG
gtaagaagtccccacctctaggaacctagtccccagaacttgggctggtgaggcaggcct
aggcattgctttaagttctgggacatttctggaatcaaaagtttgtctccaggacagcca
ggttcctgcatcttaggacttttctcatcacctagacgagggagggtcagcttacaggga

Exon  5 +      13058      13131   1   Internal     74   100   Excellent
agggatggtgatggtacccacctcagaagggggcttcacagctcagtgcatgtgaggcac
acgaggggtgagcgctcagcacctggctttgatgagcagctggtttgtggggaggtgctg
gggaggggcaggtgaggctggaaagggagtccctcagtcccctccgtgtccgatcctcag
GGATGGTGTCAGCGGGCCAGGCCGACAGCTCCAGCGAGGACACCTCCAGCTCCAGTGATG
AGACAGACGTGGAG
gtaattgccacccatccctaggagttgccctctcccagcctctaacccttccaggaacct
gtctggggcttcagacaccagtgggcccagatgagttcagcaactgtggtagggtgacca
ggagctggaaaggctgcagccggagaggggcagggagaggagtctggtgctgcttgctgc

Exon  6 +      15535      15730   0   Internal    196    93   Excellent
ctttaagccttgtgtacttttctggaaaatggatctaaagctaatagccgtctcagggag
ttgcttaaaaatccagtgacattaggaaagagctttatcaactgctgaagcccctaatac
agaaccttagggggaaacagtaattattattcattttctaattccatcctcttgttccag
GGGAAACCCTCAGTAAAACCAGCCCAGGTCAAAGCCTCATCAGTTTCTACTAAGGAGTCT
CCAGCAAGAAAGGCGGCCCCAGCCCCTGGGAAGGTGGGGGATGTGACACCCCAGGTCAAA
GGAGGGGCCCTGCCCCCAGCCAAGAGGGCCAAGAAGCCAGAAGAGGAGTCAGAGAGTAGT
GAGGAGGGATCTGAAA
gtgaggaggaggcccctgcagggacacgaagccaggtgaggcctggaggagggctgcccc
ttggaggacctgcgggtcccccagcagcctgagcactctgccatgagcacctctgccact
ggagttggggagagggaggactatggtgtgaagttgaagagcaagaacagcctgcttccc

Exon  7 +      17803      17915   1   Internal    113    85        Good
ggcctctggactttatcctaaaggcatcaccagagagttttcacaagcaggagagcaagc
tgccctttctttttcaccaggtaaaggcctctgaaaaaattctccaggtcagagctgcct
cagcccctgccaaggggacccctgggaaaggggctaccccagcaccccctgggaaggcag
GGGCTGTAGCCTCCCAGACCAAGGCAGGGAAGCCAGAGGAGGACTCAGAGAGCAGCAGCG
AGGAGTCATCTGACAGTGAGGAGGAGACGCCAGCTGCCAAGGCCCTGCTTCAG
gtgaggcctgaggagggagactccatgcagccaggcccgtccccagaaggccttctcagg
acttgttctcccactctgggccagagccccgggcgtgcctcagaccccagccccttactc
ccctctcactgtgtggcatcatttgccctatctggtcttctgtacgtggtgtcctgtgtc

Exon  8 +      18146      18340   0   Internal    195    99   Excellent
ccttctcaggacttgttctcccactctgggccagagccccgggcgtgcctcagaccccag
ccccttactcccctctcactgtgtggcatcatttgccctatctggtcttctgtacgtggt
gtcctgtgtctcctcacacgtccatcctctgggctgtctccccttgtcttgtttctccag
GCGAAGGCCTCAGGAAAAACCTCTCAGGTCGGAGCTGCCTCAGCCCCTGCCAAGGAGTCC
CCCAGGAAAGGAGCTGCCCCAGCGCCCCCTGGGAAGACAGGGCCTGCAGTTGCCAAGGCC
CAGGCGGGGAAGCGGGAGGAGGACTCGCAGAGCAGCAGCGAGGAATCGGACAGTGAGGAG
GAGGCGCCTGCTCAG
gtgaggcagaggggaggggtggagagtagccccatgcctaaaccccagcacctgcatggg
tgtggccacctttgccacatccagctcctgtctccacacgtccaccctctgggctctccc
ctcatcctgtttctcactccaggcgaagccttcagggaaggccccccaggtcagagccgc

Exon  9 +      18483      18692   0   Internal    210    76        Good
gcgaggaatcggacagtgaggaggaggcgcctgctcaggtgaggcagaggggaggggtgg
agagtagccccatgcctaaaccccagcacctgcatgggtgtggccacctttgccacatcc
agctcctgtctccacacgtccaccctctgggctctcccctcatcctgtttctcactccag
GCGAAGCCTTCAGGGAAGGCCCCCCAGGTCAGAGCCGCCTCGGCCCCTGCCAAGGAGTCC
CCCAGGAAAGGGGCTGCCCCAGCACCTCCTAGGAAAACAGGGCCTGCAGCCGCCCAGGTC
CAGGTGGGGAAGCAGGAGGAGGACTCAAGAAGCAGCAGCGAGGAGTCAGACAGTGACAGA
GAGGCACTGGCAGCCATGAATGCAGCTCAG
gtgaggctggaagccgccctgcatggcctgtgccctgcctcaaaagacctcctgtggttt
tgacttttcctctctgaacctagagccctgtgcggctggcttcgtttgctctcctcccct
cactcacattctccttctggactccctccctaatcttgtcctttgtgtctcccaggtgaa

Exon 10 +      18868      19083   0   Internal    216    83        Good
ctcaggtgaggctggaagccgccctgcatggcctgtgccctgcctcaaaagacctcctgt
ggttttgacttttcctctctgaacctagagccctgtgcggctggcttcgtttgctctcct
cccctcactcacattctccttctggactccctccctaatcttgtcctttgtgtctcccag
GTGAAGCCCTTGGGGAAAAGCCCCCAGGTGAAACCTGCCTCTACCATGGGCATGGGGCCC
TTGGGGAAAGGCGCCGGCCCAGTGCCACCCGGGAAGGTGGGGCCTGCAACCCCCTCAGCC
CAGGTGGGGAAGTGGGAGGAGGACTCAGAGAGCAGTAGTGAGGAGTCATCAGACAGCAGT
GATGGAGAGGTGCCCACAGCTGTGGCCCCGGCTCAG
gtgaggccccttcctgtaaggctctttctttttcccccccactcagagtggagctgcctg
tggcctcccaacctcacactgggactctgtctacaatcttagtttcttaatgtctgcaca
cacctaccctgggctccctctcccgatcctgtgtatctcactccaggaaaagtccttggg

Exon 11 +      19250      19438   0   Internal    189   100   Excellent
tggccccggctcaggtgaggccccttcctgtaaggctctttctttttcccccccactcag
agtggagctgcctgtggcctcccaacctcacactgggactctgtctacaatcttagtttc
ttaatgtctgcacacacctaccctgggctccctctcccgatcctgtgtatctcactccag
GAAAAGTCCTTGGGGAACATCCTCCAGGCCAAACCCACCTCCAGTCCTGCCAAGGGGCCC
CCTCAGAAGGCAGGGCCTGTAGCCGTCCAGGTCAAGGCTGAAAAGCCCATGGACAACTCG
GAGAGCAGCGAGGAGTCATCGGACAGTGCGGACAGTGAGGAGGCACCAGCAGCCATGACT
GCAGCTCAG
gtgaggcctggggaaggaggctgctacatggcctgatctgccacaccacagtcagcaccc
ccggggagctgtgctccctcaggcagagcatgggttttggctggtggggcagaacagatg
ggggactctgagttcaggaaccttctccagcctttctttggtgtcccctcaggcaaaacc

Exon 12 +      19952      20149   0   Internal    198    54    Marginal
cacccagagaccagcagaggattcttcaagcagtgaggaatcagatagtgaggaagagaa
gacaggtcttgcagtaaccgtgggacaggtgaggcctgtgttttctgggcgggcctcagg
gccgcccctacgtggtcctttggactcctggagacacctctcttccccttgtcatcccag
GCAAAGTCTGTGGGGAAAGGCCTCCAGGTGAAAGCAGCCTCAGTGCCTGTCAAGGGGTCC
TTGGGGCAAGGGACTGCTCCAGTACTCCCTGGGAAGACGGGGCCTACAGTCACCCAGGTG
AAAGCTGAAAAGCAGGAAGACTCTGAGAGCAGTGAGGAGGAATCAGACAGTGAGGAAGCA
GCTGCATCTCCAGCACAG
gtgaggcctagaaggagcaggcccatcccacccacacctgttcctgagccagggctgagg
atgggcttgactgggggctagtgttgcctgcaggtgtgcagaagcctcagaggtagcctc
aacacagcttccttccctatctttcactccatgtctcctctgcccatcagagctccaggg

Exon 13 +      22758      22937   0   Internal    180    79        Good
ggggccagaagccacaggaggtgtggagggttggggtagagaggaggaccagtcactgag
cccagccaggagaaggtgcgtgcatgggcaggccacccacccagagttgtgccatagtgg
ggagtgggacctgaaaggaatcacttttgcctccaatactattatccccctgcaattcag
GTGAAGCCACCAGTGAGAAACCCCCAGAACAGTACCGTCTTGGCGAGGGGCCCAGCATCT
GTGCCATCTGTGGGGAAGGCCGTGGCTACAGCAGCTCAGGCCCAGACAGGGCCAGAGGAG
GACTCAGGGAGCAGTGAGGAGGAGTCAGACAGTGAGGAGGAGGCGGAGACGCTGGCTCAG

gtgagggggagggaatggagatcatcccctacatgggatgtaacacctttgccacatcca
gctcctgtcttctcacacgtccaccctccaggctctctcctctcatcctgtttctccctc
caggtgaagccttcagggaagacccaccagatcagagctgccttggctcctgccaaggag

Exon 14 +      23061      23261   0   Internal    201    72        Good
tcagggagcagtgaggaggagtcagacagtgaggaggaggcggagacgctggctcaggtg
agggggagggaatggagatcatcccctacatgggatgtaacacctttgccacatccagct
cctgtcttctcacacgtccaccctccaggctctctcctctcatcctgtttctccctccag
GTGAAGCCTTCAGGGAAGACCCACCAGATCAGAGCTGCCTTGGCTCCTGCCAAGGAGTCC
CCCAGGAAAGGGGCTGCCCCAACACCTCCTGGGAAGACAGGGCCTTCGGCTGCCCAGGCA
GGGAAGCAGGATGACTCAGGGAGCAGCAGCGAGGAATCAGACAGTGATGGGGAGGCACCG
GCAGCTGTGACCTCTGCCCAG
gtaagacttgccaggcctctgagccaccaacactcactcctcagaacgggggtatagggc
tgggcgtggtggctcacacctgtaatcctagcactttgggaggccgaggcagatgtatca
cttgaggtcaggggttcaagaccagcctggccaacatggtgaaaccccgtctctactaaa

Exon 15 +      26576      26701   0   Internal    126    73        Good
tagcagggtggaagcatgtttccagtggctgtggggcaggtcaggccagcaggtatccct
gtgcatgtgcaggaaggggccacgctgcctcccctggaaaccagagtgcctgagggtcat
tgcctactggctgtttccccctcagcaaatgccccactccccgaccacgtgcttatccag
GTCTTGTCCCCTCAGAAGGACAGTAACTCCAAACCTGCCAGAAGCAAGACCCTGGCCCCA
GCACCCCCAGAGAGGAACACGGAGGGGTCCTCGGAGAGCAGTGAGGAAGAGCTGCCACTG
ACCCAG
gtgcgccatgccttctctctgcagatgctgcaggatcagagctgggctggcaggccttgc
aggagagggcagatcttgcccatagggaaaatctcgccatatttaaacagcacctcacag
cttccagagctctttcctctattgtgacattcatctgagccctgtgaggcaggcagcagt

Exon 16 +      31431      31617   0   Internal    187    93   Excellent
ggtcttagcagatgtgtggggtgggagggggcaccctgggcagctggaatggcttctgtg
cccagctgcccctgagctcagtggaccctttgccttgtaaaacactccctaaccccatca
cctcctttccctggccaagcctttaatcactgggggggtgttttgtttttgtttttcaag
GTGATTAAACCCCCTCTGATTTTTGTCGACCCTAATCGTAGTCCAGCTGGCCCAGCTGCT
ACACCCGCACAAGCCCAGGCTGCAAGCACCCCGAGGAAGGCCCGAGCCTCGGAGAGCACA
GCCAGGAGCTCCTCCTCCGAGAGCGAGGATGAGGACGTGATCCCCGCTACACAGTGCTTG
ACTCCTG
gtgagcgcagcccttatgcagtggtgggaggggctgccagcactgccccacattgaggcc
cagaagggacaggacactggctgagtcacatagcaaggtgttggtcgggaggggcttggg
gtcaggtctctgggccctgcattagccattctgattagggcctggctcagacctgcagtt

Exon 17 +      33416      33552   1   Internal    137    77        Good
gacataatgacatctcctgcctgggaggcttggagagggaagtaaacaagcttctacctc
tgtaagccctgagcacagctctagatcaccagcacaggccggtaaattgggttattgccg
ctgctgaggaggcgatggggcttttgtgccctgatgtgcccccatctcgctccatttcag
GCATCAGAACCAATGTGGTGACCATGCCCACTGCCCACCCAAGAATAGCCCCCAAAGCCA
GCATGGCTGGGGCCAGCAGCAGCAAGGAGTCCAGTCGGATATCAGATGGCAAGAAACAGG
AGGGACCAGCCACTCAG
gtacctggtgggcaagggagggtaatgcaggccagtggggtggggccctacttccatact
tacccacatgtgctgatgggatggcctgcaattgctgtcacgcccacactccagaggtcg
tggcctcacagccagaggctttctggcctcctagctacaaccccccaaatcacctttgag

Exon 18 +      35073      35142   0   Internal     70    72        Good
gctccttgagaacaatgtgattcgctcataacctgaagcctgccaccagttttgcccctt
tgactgcccctcagtccctgctccagccctcaccccagccagacagcatctgaccagggt
gtggcacagctggcatcccaaggacttgtgagtctgagggctacctcttgccacccacag
GTGTCAAAGAAGAACCCAGCTTCCCTCCCACTGACCCAGGCTGCCCTGAAGGTCCTCGCC
CAGAAAGCCA
gtgaggctcagcctcctgttgccaggacccagccttcaagtggggtgagcttggggagcc
aggggaagcaagcccacggagcgtagaaggtgcaggcgtggccctgcatcgcggcaccag
cactcatctgccccatgacctctgcacttggtttgcctccctcggcctcagtggcctaat

Exon 19 +      35486      35705   0   Internal    220    98   Excellent
ggcctcagtggcctaatctgtaagaaggaattacagtacctttcgtagttggaaggatca
aatgaggctgcatgtgtgccccatctaacacagttcctggccctactgaagtgttcagga
aggaccaggtcttacttgccctaatttttccttccattccttctcctttcaccgaattag
GTTGACAGTGCTGTGGGAACACTCCCTGCAACAAGTCCCCAGAGCACCTCCGTCCAGGCC
AAAGGGACCAACAAGCTCAGAAAACCTAAGCTTCCTGAGGTCCAGCAGGCCACCAAAGCC
CCTGAGAGCTCAGATGACAGTGAGGACAGCAGCGACAGTTCTTCAGGGAGTGAGGAAGAT
GGTGAAGGGCCCCAGGGGGCCAAGTCAGCCCACACGCTGG
gtgagggtgccaggggaaaggcaagggtgggccaggaagagggtgttgtgtggcctggtg
gagccatagctctggcctcagctccatatctcagactcattctgcacctgtggctgagcc
tgggcctcagtttccccacctgtacaacttcatgaggaagtcaatccaaatgatttcaga

Exon 20 +      36253      36319   2   Internal     67   100   Excellent
tgtgcaaggagtgttgaagcagtaggaagacttgtggtgaggcggggcaggggatggggg
tgagggacctgcagagagaccagggccttcctgaagggctctgcccttcccggctggcag
gggccacctggggctaccaacaggatactgtgcttctccagtaggtcccaccccctccag
GACAGAGACCCTGGTGGAGGAGACCGCAGCAGAGTCCAGCGAGGATGATGTGGTGGCGCC
ATCCCAG
gtaactgcaagggagaggactggcagcccataggccttagggtggagccccaggccaggc
tcctgtctacccgatccctcaggtcaggggtctgggtcccctctcttcacagaggccttg
ggcaaggtcctgtctgcaaggcaccacgtgtggcccagccagcagaccacagccaggctg

Exon 21 +      39960      40143   0   Internal    184    89        Good
agatctgtgaccccacattctctctccataggtggaaaagaggctgcttcaggcaccaca
cctcagaagtcccggaagcccaagaaaggggctgggaacccccaagcctcaaccctggcg
ctgcaaagcaacatcacccagtgcctcctgggccaaccctggcccctgaatgaggcccag
GTGCAGGCCTCAGTGGTGAAGGTCCTGACTGAGCTGCTGGAACAGGAAAGAAAGAAGGTG
GTGGACACCACCAAGGAGAGCAGCAGGAAGGGCTGGGAGAGCCGCAAGCGGAAGCTATCG
GGAGACCAGCCAGCTGCCAGGACCCCCAGGAGCAAGAAGAAGAAGAAGCTGGGGGCCGGG
GAAG
gtggggaggcctctgtttccccagaaaagacctccacgacttccaaggggaaagcaaaga
gagacaaagcaagtggtgatgtcaaggagaagaaagggaaggggtctcttggctcccaag
gggccaaggacgagccagaagaggagcttcagaaggggatggggacggttgaaggtggag

--------------------------------------------------------------------------------