--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (28259 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1422       1814   0    Initial    393    89        Good
taaggccagccgcggcaggaccaaggcggcggtgtcagctcgcgagcctaccctccgcgg
acggtcttgggtcgcctgctgcctggcttgcctggtcggcggcgggtgccccgcgcgcac
gcgcaaagcccgccgcgttccccgaccccaggccgcgctctgtgggcctctgagggcggc
ATGCGGGACTACGACGAGGTGACCGCCTTCCTGGGCGAGTGGGGGCCCTTCCAGCGCCTC
ATCTTCTTCCTGCTCAGCGCCAGCATCATCCCCAATGGCTTCACCGGCCTGTCCTCCGTG
TTCCTGATAGCGACCCCGGAGCACCGCTGCCGGGTGCCGGACGCCGCGAACCTGAGCAGC
GCCTGGCGCAACCACACTGTCCCACTGCGGCTGCGGGACGGCCGCGAGGTGCCCCACAGC
TGCCGCCGCTACCGGCTCGCCACCATCGCCAACTTCTCGGCGCTTGGGCTGGAGCCGGGG
CGCGACGTGGACCTGGGGCAGCTGGAGCAGGAGAGCTGTCTGGATGGCTGGGAGTTCAGT
CAGGACGTCTACCTGTCCACCATTGTGACCGAG
gtgggtgccggcccctgctggggctgagaccagggctcggaggacctgtcgcggtccttg
aacccgagctcctctctcccagatgcgcactggacgctgtcactccccctcccccaacgg
tcaacaccctagcgatggagaccctccagccaggtggcttgggaacgcttcacgaggtga

Exon  2 +       2309       2361   2   Internal     53   100   Excellent
ttactctagttggggttgggggtggtaagtagcagagccaggacttgggccaggggctat
cccgtttttcctctagtctcttgatttctttttagaagagaagaaatacttctctttcct
gaacttttaaaagttaaataaagcatgtgtatacaactgcctcttccctttttcctctag
TTACTCCTTCCCCTACCGTCCACAACCCAAAAACGACAATCTGGTCATGCCCT
gtaagtaattgtttgccttttcccatggtcagttgtcagtcttttttttttttgagacag
agtctccctctgtcaccaggctggagcgcagtcgtgtgttcttggctcactgcaaccttc
gcagtcgtgcgttcttggctcactgcaatcttcgccttccgggctcaagtgattctcctg

Exon  3 +       9827       9930   0   Internal    104   100   Excellent
ggatgggaaagaagcctgctctctgccttcctgcccaggtgagccatcacctgactaagt
gagttcacactcagagcgtgtggggatggcaggatgttctgacttcattttccaggatgc
ctttgctttaaaaccttttaaaaagaagtgaatgatacaccccctttgctcatcttgcag
TGGAACCTGGTGTGTGAGGACGACTGGAAGGCCCCACTCACAATCTCCTTGTTCTTCGTG
GGTGTGCTGTTGGGCTCCTTCATTTCAGGGCAGCTGTCAGACAG
gtaaggtgtctgtcttctggagcaccaggggacctcagcactgaggaagaagcgtgtgcc
tggcccttgatttcagttggtagtattctttcagcgcagggccctgtattttaaagaaga
ggaagctatgtctgtgatatagactccatgcctagtaagaagagccaacaaatctgactc

Exon  4 +      15596      15774   2   Internal    179   100   Excellent
gtggggagggggagaaatagcatgggcactgtgagaccgagactgtccctggcagccagt
attctggcaacactgttcacacccacttactggatggatcttgagaaagccccacttggt
ggagcccattcctgctgcccttttccagctggttatctgtcactctccttttcttcccag
GTTTGGCCGGAAGAATGTGCTGTTCGTGACCATGGGCATGCAGACAGGCTTCAGCTTCCT
GCAGATCTTCTCGAAGAATTTTGAGATGTTTGTCGTGCTGTTTGTCCTTGTAGGCATGGG
CCAGATCTCCAACTATGTGGCAGCATTTGTCCTGGGTATGACCATCAGGTTGGAGTTGA
gtacttgatcctgtatttcaccatcatcccatcacctacctttctggagacaactgtgat
gtccctcaagggggacagggtttctaacaaaactagccagagcttcctggtgaaccttac
ttacaggcagggaaactgagccagacatgagaccagcctggggtccccagcagcacaatg

Exon  5 +      16777      16948   1   Internal    172   100   Excellent
tgtacccccaggagacagtcagacaggaggggttcagaacgccatccgctccctagcgcc
atgaacttagagagagttctcgctgttttcttgtctgtgtattcacaaagataccataaa
aaattaataaggaaggaacccaaattaaactgctaactcgacctcccttgttttgaacag
GGACAGAAATTCTTGGCAAGTCAGTTCGTATAATATTCTCTACGTTAGGAGTGTGCATAT
TTTATGCATTTGGCTACATGGTGCTGCCACTGTTTGCTTACTTCATCCGAGACTGGCGGA
TGCTGCTGGTGGCGCTGACGATGCCGGGGGTGCTATGCGTGGCACTCTGGTG
gtgagtgtgaccttgtgccccatgtgcccactggcaggatgatttctgtctggccttcac
tagagggcagcaacaacccatgaatccctattttgtctcccagagacaggaagcatagat
tataaattatttcagaatgttttctccacactcaaaagagccaaaacaaaacagaatccc

Exon  6 +      18474      18600   2   Internal    127    98   Excellent
ctcatccaccccaggttattgctgcgtgtggatcagctctttgcttctggcttgtgatca
ccaaacattccacaagctctggttctgcaaccttattcccacctatggctgtgctctacc
tggtctgtgggtctgctgttggcagggaggcctcactgagattggaccttgtactgccag
GTTCATCCCTGAGTCCCCCCGATGGCTCATCTCTCAGGGACGATTTGAAGAGGCAGAGGT
GATCATCCGCAAGGCTGCCAAAGCCAATGGGATTGTTGTGCCTTCCACTATCTTTGACCC
GAGTGAG
gtaagcaccatgtgggtgtgggtgagagggacagactgaccgtgatttgagagcagcagc
acccagccctgaagtcctccctgctcacagcagcccagccctctctccgcccaagcccca
actgcccattccccccatccccccactccccacccccacacgggccctgttaacactcag

Exon  7 +      19486      19575   0    Initial     90    59    Marginal
actatgagaggttagaagctgtaaatgctgcctggtggggttctggaatgtgtctgtggt
ctgactggaagatgaggggttgggtgtgggaacagccacaagcagccctgctgaagtgtg
agaggcaggcatggttgggcttggaaaagagggaacagttattgtagacagcggaggcca
ATGGCCACTGCCAGCCCTGCAGACTTCCCAGTGAGTGGTGGCCCAGCAGCCACTGTCAGC
ATGCACCAGAAAGGGGTCCTGTGCGCAAAG
gtcaggcaggagtgtggcagagggcttttaagttaggtggttttgggggcttttaagtga
ggggtcaatctgggtgaatgcataagccccactggcatctttgaggaaatgaggctattt
caggggatactttcagtccaaagttgaccttttgttgaacttctaactctggaaaaacaa

Exon  8 +      20370      20470   0   Internal    101    90   Excellent
ggcctagggaagttttcacagcctaaaacacagtcagtatacttactgttcttagaaacg
taacactccccgacgctgagatgcagacagctaagatgccagggattcaagtatgttatt
gtgtgctctgagtctctgaccacctcttcttcccatacacttatgatgttgttcctgcag
TTACAAGACCTAAGTTCCAAGAAGCAGCAGTCCCACAACATTCTGGATCTGCTTCGAACC
TGGAATATCCGGATGGTCACCATCATGTCCATAATGCTGTG
gtatgtaaaagagacctgcctgaggcttccagacaaagcttcttgaagtggccattgggc
ctcttgtttacagacatgcctcagacaaaattcaaagcctatgtcatcagagagtgaaaa
ggatatgtcttgtgttagatggaaaaaatgggcatgtcacaattcttaatgggatggaac

Exon  9 +      22139      22353   2   Internal    215    70        Good
gctggggaaaattatcttttgatctatgaagtaagacgcagggttacagttactgctgcc
ttactagtctctgcttaaagatggtttggaatttactgaaataattgcattgtaaaagtt
gtacaggttgggaaagatgtggatactgcttttccagctttcttctgcactctgtttcag
GATGACCATATCAGTGGGCTATTTTGGGCTTTCGCTTGATACTCCTAACTTGCATGGGGA
CATCTTTGTGAACTGCTTCCTTTCAGCGATGGTTGAAGTCCCAGCATATGTGTTGGCCTG
GCTGCTGCTGCAATATTTGCCCCGGCGCTATTCCATGGCCACTGCCCTCTTCCTGGGTGG
CAGTGTCCTTCTCTTCATGCAGCTGGTACCCCCAG
gtagggaccatgtgcatctatggtttggggtcttcactgagtctcttactgtctaccagg
ctgtctcaattaataaagagaataaaatcaagcccatcacagctcccttgcttatataca
ttcttggcctaaaaatcaatagaaagtgtcttctgagactagaacacttatggcctgggc

Exon 10 +      22698      22823   0   Internal    126    74        Good
cacttatggcctgggctttgagggagtgggaaaaagcagccattggggctgttggttaat
tttactctgtacccaagttaatgtgctcatactgttttccactgcagaagaagagggaag
aaatagctatcccattcctttttttcctggccctgtcttctttatttattcaacaaatag
CTATGGCATGCCTACCATGGGCTGGGCACTGTGCTCGGTGATAACGATACACAAGAAAAC
AAGCCAGGCAGAACCCCAGGCCCTCATGGAACGTACACCCTAGATGAGAAGACAGACAAC
AAACAA
gtaaataaaatgcttaatatagttcagactgtgttaccttctaggaatacaaatgaagga
caatgccgagttagtttacatagtcacagatagtgtccctgaacagggggcagttcagta
gaaatgtacataaagtgacagaaagccctgaaaaagtctaggagaacattttaggaagaa

Exon 11 +      23882      24064   1   Internal    183   100   Excellent
agcctcctttcagcaatcaatttggagggaaatcttggctatagccccttcccccacaat
aggaagtgatagaaactgactccccaaaaaatttgggaagaaagtatgtttgttttgctc
tcaatagctgcatgccatgggttggtacctactcctaccctctttcctttgcttctccag
ACTTGTATTATTTGGCTACAGTCCTGGTGATGGTGGGCAAGTTTGGAGTCACGGCTGCCT
TTTCCATGGTCTACGTGTACACAGCCGAGCTGTATCCCACAGTGGTGAGAAACATGGGTG
TGGGAGTCAGCTCCACAGCATCCCGCCTGGGCAGCATCCTGTCTCCCTACTTCGTTTACC
TTG
gtaagtcccatgagccaagggcacactagagcaacgggatggaagtactaactggcttga
atgtgagctggaggttgcgtgttaacaggaaaacaagttcatacagtacatgggctccat
ccagtactggatctttggccgggaagggttcttgtcccagtgcactggccctcactttca

Exon 12 +      25125      25264   1   Terminal    140   100   Excellent
agctctgggttctgaaacctgtctagatgccagattctaatctgactgctcagactgtga
gagatgtgagaccaagaaggaaagtgatccccttccagagtcctgggagcataaaggggt
agatgagagaccaagtctaactgcagccctgggcctgaggctccgtctgctttgccatag
GTGCCTACGACCGCTTCCTGCCCTACATTCTCATGGGAAGTCTGACCATCCTGACAGCCA
TCCTCACCTTGTTTCTCCCAGAGAGCTTCGGTACCCCACTCCCAGACACCATTGACCAGA
TGCTAAGAGTCAAAGGGTAA
gaagacctcctctgtcagtgttgatgcactgggtctgggtctggccaggtctcaggagcc
cctcacaatagagctactcgcaaactccctctcacagacaccatggactagtttagccat
taaagggttgtaaatggcaaggtgcttacttatagcccatcctctctggtctgttcctgt

--------------------------------------------------------------------------------